Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24436  (registered. 2003)
Contig Information
Length 2067 bp
Clones 29 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 10
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 1
Wh_VWD Shoot grown with dessication 8
Homology (BLAST) Top Hit myo-inositol-1-phosphate synthase [Avena sativa]
Score 2588
Evalue 0
Total Hit Count 452
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24436
CAAAAAACAGGTACTGCTTCGCCGTCCCTGAACGACCGGGAGGTGACATGATAAAAGCAGAGCACACAACTCGCCGGTGAACCGATTTAAAGTTCCATAT
ACTAGTAGCACACATACTACTAATTAACTTACAAAACACGAACAGAGGGAGTGGACTAACTTAGCTAACACGAACCCTCCTCCCTCCACATCATCCAACA
CCATGGAGCCCATGAGAAGCTACCAAGTCGCAGAGACCAGACAGAGAGCCGAAATAGTCTCGCAAGGACACACACACACACTACAGGGTAAACTTAAACA
AGGGAAAGAATCGCAAAGGAAACTAAAGACAAGCCGCCAAATAATTGCACAGCCGATCTCGCCTTCTTCTTCCTCCTGCCCTCCCGTCGCCCCCCGCCAC
TTGCTACATACGTACGGTCGCTCTCGGCCCTGCGAGCTTGGGCCATGCTCCTCACTTGTACTCCAGGATCATGTTGTTCTCGGGCGCCAGGCCGACGCAG
GCCCTCATGATGTTCTCCAGCATCGCCCTCTGCTTCGCCAGGGCGTTCACCACCGGTGTGCCAGGAGGAACCAGGGGTGCCTTGGTGAGGTAGCTCAGGA
TGGTGGCAACCGGATGGAAGGAGTGGAACTTGTCCTCTCCCTCGGCTTTCAGCTGAATCCTGGTGCTGAGCTCGGCCAGGAGCACCAGGTCAAGGATGAT
GGGTGCGGCGAGGAGCGAGTCCTCGCAGGTGTTGTGCAGCACGATGGTGCTCTTGCCCCCCATGAAGATCTCCGAGGTGTACTCGTCCATGGCCCTCTTG
CTGTCTCCAACGTATGGCACATACTTGATCACGACGACGTGGTCAGGATGCTCCCCGGGCTCGTAGAGGATAGCATTGCTCGAGACCATGTCATCCACCA
CGTTGCTCTTGGAGATCTCCTTGGAACGGAATGTCTGCGGTGCGGATAGGTTCATCCCGTCGTTGTTCCCCAGATGGTTGTAGCTGACAATTGAGGTGGG
CTTGATTCCAGCACCAACAAGGAAATCCACCAAGACAGATTTCATCTTAGTCTGGCCACTCTTGAAATCATCACCACCAATCAGGCAGTTGTTCTTAATG
GCAAGATCGATCAGCCCAGGCACAAAGGTGTTCTGAGGGCTCCCGTTGATGAACGGCACACCCTCCATGACGCAGGCAATGGCATACAGTGTCGATGGAG
ATATCTCTGCCTCGTTCTTGTCCACAGACGCCAAGAGGTTCTCCATCGTGTCATTAAGCCCAACAGAGACGTTGCTGTACCTTTCAGTGTTTGCCGTCCA
AAGCACCACTACCTTGTCCACCTTGTTCTTCTCCTTGAACTCCCTTATGTCTTTGATAATCTGCTCCATCTGCTCTTTCTTTGTGCCCTTGATGACATTG
TTAGCCCGGGAGCCCTGGTTGGCAGCGATGAAGTCCGGGTCATAGATGCCGGGGAGCGGCACGATGGACTCCATGTAGGGCCTGAGCTGCTTCTGCAGGT
CAATGTCCAGCACCTTGGCCCTGGTCATAGCATCAGCCAGGTTCATGCTGCTAATATCCCAGCCCCCAAACACAAGGTCATCTGGGTTTACCATGGGCAG
GAGGCTCTTGAAGGGTGCATAGATCTCCTCTCCGTTGTAGCTCCCGACCCTGATGGTGGAGGCCTGGGTGAGGGACCCAAAGTAGTTGGCTTGCTGCACC
TTGTCCTTTGTCGCCCATGAGATCCCCTCCCTGTTGGCGATGACCCCAGCCATGAGTGTGGAGCCATTGTTGCCGCCCCACCCCACGAGCATCACCCCGA
GCTTGGGGACGTTGGTGTTGGTCTTGAAGTGGTAGTTGACGGACTTGGGGCGGACGACCCACTTGGAGGCGCCGTCGTGGCTCTCGTGCACCAGCTCCGT
GGTGTCGTAGCGGTACTCGGACTCGATCTCCCCCGCGCCGTACCTCACGTTCGGGCTCTCCACGCGGAAGCTCTCGATGAACATCTTGGCGACGCAAGAT
CGATCTCTCCCTCTCTTTCTTTCCTGGAGACTCTTGCAGGGAGGAAGAGAGAGGTTTTCGAGTGCGG
page-top