Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24390  (registered. 2003)
Contig Information
Length 1388 bp
Clones 29 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 4
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VWD Shoot grown with dessication 18
Homology (BLAST) Top Hit RecName: Full=Nucleotide pyrophosphatase/phosphodiesterase
Score 1749
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24390
GTACTTCTACAAGATTGGGCATGAGCTCTCCGACGGAACCGTGGTGTGGGCTAAGCCCTACACCTTCCGGGCACCGCCAACCCCCGGCCAGAACTCGCTG
CAGCGCATCATCCGTCTTCGGTGACATGGGAAAGGCGGAGAGGGACGGATCAAACGAGTTCGCCAACTACCAGCCAGGATCGCTCAACACGACGGATAGG
TTGATTGAAGATCTGGACAACTACGACATCGTCTTCCACATCGGCGACATGCCCTACGCTAACGGGTACCTCTCGCAGTGGGACCAGTTCACCGCACAGG
TTGCCCCCATCAGCGCCAAAAAGGCCTACATGGTTGCAAGTGGCAACCACGAGAGGGACTGGCCCAACACCGGTGGGTTTTTCGACGTCGAGGACTCCGG
CGGCGAATGCGGCGTGCCCGCCGAGACCATGTACTACTACCCAGCCGAAAACAGAGCAAACTTTTGGTACAAGGTGGACTATGGGATGTTCCGGTTCTGC
GTGGCGGACTCGGAGCACGACTGGCGGGAGGGGACTCAACAGTACAAGTTCATCGAGGAATGCCTCTCCACGGTGGACCGCAAGCACCAGCCGTGGCTCA
TCTTCACGGCGCACAGGGTGCTCGGCTACTCCTCCAACTCGTGGTACGCCGACCAGGGCTCCTTCGAGGAGCCAGAGGGCCGGGAGAGCCTGCAGAAACT
GTGGCAGAAGTACCGCGTCGACATTGCCTACTTCGGCCACGTCCACAACTACGAGCGTACATGCCCACTCTACCAGAGCCAGTGCGTCAACAACGAGAAG
AGCCACTACTCGGGCACCATGAACGGGACCATCTTCGTCGTGGCCGGCGGCGGCGGTAGCCACCTGTCGGAGTACACCACGGCGATCCCCAAGTGGAGCA
TATTCAGGGATCACGACTACGGGTTCACCAAGCTGACGGCCTTCAACCACTCGTCGCTTTTGTTTGAGTACATGAAGAGCAGCGATGGCAAGGTCTACGA
CTCCTTCACCATCCACAGGGACTACCGTGACGTGCTCAGCTGCGTGCACGACAGTTGCTTCCCCACCACACTCGCTAGCTGATGGTCTGGCCGTTCATGG
AGGGTCATGCAATAAAATTGGTAAGCCGCACAATTTATATGTACTAATAAACAAATCTCGTGGGCGTGAGTACCTGGTGTCCAACCGTCATGGAGTATCG
AGCAATAAAATTGGTCAGCTGCACTATTTATACGTGCTAATAAAAAGATCTCGTGGGTATGAGTTGGTGTTAGATGTGCGCATACTAATCATACAAGAGG
CAGGTGTATGCTAATTATGCTTTGTAACTCCTTGATATTATATTATGGAATGATAAAAGCATCATTTATCGAAAAAATAAAAAAAAAA
page-top