Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24368  (registered. 2003)
Contig Information
Length 879 bp
Clones 28 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 3
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 8
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 6
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 1
Homology (BLAST) Top Hit USP family protein [Triticum aestivum]
Score 681
Evalue 1.26652e-69
Total Hit Count 141
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24368
TTTTTTTTTTGGACAGCAGAATCCATTTTATTCAGACTCTACAAACTGTATGCAACAAACAGCAGCACGGACTGACTCATGGAGCAAAAGCTAGGCTGAA
GATAAGCACACAAATGTACAGGATGTACAGGACACATGCACAGATTACACACACCTGGGAATCATCCACAGGCTAATTGTCAATTATTATTACAAATAAC
ACTGGATGGTTCAATAAGTTGCGGCCAACTGGATATATAGGACTCTGGCAAACTAAAACACATGTGGACATTTGCGATGATGAGATCAGGCATGGTTACT
CGCTGGCTTGACAACGGTGACAGGGCAGGCGGCATTGTTCACGACGTAATCGCTGACGCTGCCCAAGAGCACCCTCTTGAGCTTGCCAAGGCCCCTGCTC
CCAATGACCAGGGAGCTGATGGGCATGTCATGGATGGCTTGGCACAGCTTCTCGCGGGGATCTCCAAACAGGACTTTTGAAACCACGGAGACCTCCTTCT
GCTTAGCTATAGTGTTGAGCATGTCCAGCGTTTCAGCATCAGGCTTCACCCCATATTTCTTTGCAGTTGAAGGGTGAGAGAACTCCGAGAGGGGGATCAA
AGGCGAGCCGGAGGCCTCCCAGAGGAGGGTCTCGCCCTGCTCGTAGTCGGGGTCCTTGAGGACGTGCAGGAGGAGCAGGTTGTCGCCGGAGCGGAGCAGG
TTGTCCGCCGCCCACTGCAGCGCCGCGCGGCTCCCCTCCGAGAAGTCCACCGCCAGGCCCACCCACCTCTCGCCGTCCGCAGCCATGGCCGATCTCTTCT
CTTCTCCTCGCTCGGCTCTTGGGTGGTGGTGGAGGTCACCGCTGTTTGGAAGGAAAAGTTGGGAGAACGCAGGAACAAT
page-top