Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24365  (registered. 2003)
Contig Information
Length 943 bp
Clones 28 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 9
Wh_VABA Shoot with ABA treatment 7
Wh_VHS Shoot with heat shock treatment 3
Wh_VWD Shoot grown with dessication 4
Homology (BLAST) Top Hit ORF 62
Score 344
Evalue 1.68635e-30
Total Hit Count 238
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24365
TTTTTTTTTTCTATCCGCCTGGGTCGACCTTCTATGTCTGGGTCGACCGATTTCATTTCATTTTCTATTATATTAGAGTTTTCCTTTTTTTATTATCTGT
CAATGAATATTCTAATGGGAATGGAATTTCATAATACTGAAAGAGAAGAGCTAGCAATTCGGAACGCAAATTGCGTTTTAATACGTCTCACTATTCTAAT
TTTTTAGAAGAAATGGCCTTTATTATTTCTTTTTTATGGGGTTAATAAATATTAACCAAATTTAATTTAAGAAATGAGAGAATTCAGAATAGCTACGAGA
AAGACTAGTCCAATCCATAATGATGTACCAGAAAATACAACATTTTTATTATTTGACCAACCATCAGGAGAAGCAAATACAAGGGGTACACTAATTACTA
AGACTGAGGAAGTCGCAATTAATGCAAAAACAGCTAATTGGAAAGCAATAGTCATATTTCTAATCCTCCAAGCTACCATCAAATAAAGTTGACTACATAT
TTGATCCCTCACTTAACCAAAATTGTAAAAAAATACAAGAAGTAGGAGGGGTTTAATCATGAATCCATTGATTCTTCTCTTTAATTCAAATTTATTACTT
AAACCGCTTTTTTATTTGGATATGGGGGTGAGAAGAGATTATTTACTCTTTATTTCACAAGCGGGTATAGCGGATCCTGTATCCGTGTATACAGTATACA
GAGATATATCGAAAAGGAACTTGTATCTGATATCTTTCTAGAGGCTAATAAATCTTTTTATTTTTTATATGGCTATGTTCTATTTGTAGGAGTAAAATAA
GGATTAGGCTGTGGAGAGATGGCTGAGTGGTTGATAGCTCCGGTCTTGAAAACCGGTATAGTTCTAGGAACTATCGAGGGTTCGAATCCCTCTCTCTCCT
TTTGCTTATTGAATACGTTTGTTTCTTTCATTTTTTTTTTTTT
page-top