Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24344  (registered. 2003)
Contig Information
Length 922 bp
Clones 28 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 4
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VHS Shoot with heat shock treatment 4
Homology (BLAST) Top Hit Os01g0558600 [Oryza sativa (japonica cultivar-group)] >gi|109940139|sp|P40392|RIC1_ORYSJ RecName: Full=Ras-related protein RIC1 >gi|57899331|dbj|BAD87942.1| Ras-related protein RIC1 [Oryza sativa Japonica Group] >gi|57900421|dbj|BAD87657.1| Ras-related protein RIC1 [Oryza sativa Japonica Group] >gi|113532867|dbj|BAF05250.1| Os01g0558600 [Oryza sativa (japonica cultivar-group)] >gi|125526416|gb|EAY74530.1| hypothetical protein OsI_02420 [Oryza sativa Indica Group] >gi|125570818|gb|EAZ12333.1| hypothetical protein OsJ_002158 [Oryza sativa (japonica cultivar-group)] >gi|215769435|dbj|BAH01664.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1013
Evalue 4.38188e-108
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24344
TTTTTTTTTTAACCAAATGAAGGTGAATATTAAACGAAACACATTAAAATAGCAAATATTAACAGTCAGCTAAAACAGGCCACAGCATCTGCTGCACTGT
TGTAGTTAGGGGACATGACACTTCTTCCAACAGGCGGCATGATAGTAGTACACTTAATTTACAGGGGAAGAACAACCAATTGAGTTTTGCAAGAACACTA
CTGTGATCTCCGAGTGTTGATCAAGACGAGCAGCATCCATTCTGCTGAGCAACAGGCTGACCCCGCATTTGCACGGTGGCAGGCTTGCTGGCATTTCCAG
CAGGCTGGCTTGCCATCCTGTTCTTTATCTCTGCGGCCATGGTCATAAATGCCTTTTCCACATTTGTTGCATCCTTGGCACTGGTTTCCAGGAATGGTAT
TCCAATCTCATCGGCAAGGGCCTTGCCAGCCTCGTAAGAAACCACTCTGCTCTCAGCTAGATCGCACTTGTTCCCCACCAAAAGCTTGTTCACATTTTCA
CTAGCGTACCTGTCGATTTCATTAAGCCACTGTTTGACGTTGTTGAAGCTCTCCTGGTCAGTCACATCATACACAACAATGATGCCATGGGCACCGCGGT
AGTAGCTGCTTGTGATGGTCCTAAATCGCTCTTGTCCAGCAGTATCCCAAATTTGCAGCTTTATCGTCTTCCCATCTTGCTCAACGGTGCGGATTTTGAA
GTCAACACCAATAGTACTGATATAGCTCTCCAGATATGAATCATCCGCAAACCTCAGCAGCAGGCAAGACTTCCCCACGCCCGAGTCCCCAATGAGCAGC
AGCTTGAAGAGGTAGTCATATTCGGGATTCATGGCAGCGGACGGAGGCGGCGAGTTTCTAGGAGACGAGGCGGCAGGCGATTTCCCGGGAGGCGAAGGCG
ACGACCGAGGGAGAGGAAAGCG
page-top