Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24340  (registered. 2003)
Contig Information
Length 1859 bp
Clones 28 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 6
Wh_OKCS Seed DPA5 2
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 3
Wh_VHS Shoot with heat shock treatment 7
Wh_VWD Shoot grown with dessication 6
Homology (BLAST) Top Hit RecName: Full=Catalase-1 >gi|1408512|dbj|BAA13068.1| catalase [Triticum aestivum]
Score 2665
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24340
TTTTTTTTTTAAACTCAAGAGATTATTGATATACTTACTCTTCAACTTATTCTTAATTCGGTTCATTAATCAAGATGCATTCACTTTACAATAATCATGA
AGTATGAGGAGAAACAGGCTCTTGTACAAATTATTACATGAATGACGGGCGAGAATGCGCATAACGTGTGCTGGAATCATATGTATGTCCTCTTTTCAAA
ATAGGCTCAGTAAAATGAAGTAACTAGATGCAGCATTTGGTATGTAATTCCTCGCCGATAAGAGGGATGAACCTCGACGGCCGAAGCAGATTTCTGATTT
GCGCACTCCATGGACTGATCTTACATGCTCGGCTTCGAGCTGAGACGGCTCGCGAGCTTCTGGCCGAGAGACTTGTCAGCCTGAGACCAGTAGGAGAGCC
AGATGGCCTTGATCTCGTGGGTGAGGCGGGGGTCGGACAGCGCATCGATCCATCTGTTGATGAATCGCTCTTGCCTTGCCGGGTCCATGGAGCGGTACCT
CTCCCCGGGCTGCTTGAAGTTGTTCTCCTTCTCGATCACCGTCTTCTCGCGGCGGCCGTTGAGGGTGCGGGAGGGGATGGGGTAGCGGGGCGCGTGCTTG
GCGGGGTCGAACCTGGAGGGGAAGTAGTCGACCTCCTCGTCGCGGTGCATGAAGTTCATGAGCCCGTCGTAGTGGTTGTTGTGGTGGGAGCACTTGGGCG
CGTTGGCCGGCAGCAGCAGGTAGTTGGGCCCCAGCCGGTGGCGCTGCGTGTCCGAGTAGGAGAAGATCCTCGTCTGCAGCAGCTTGTCGTCCGAGTAGTA
CACCCCGGGGACGATGATCCCGGGGCAGAAGGCCAGCTGCTCGTTCTCCGCGAAGAAGTTGTCGATGTTGCGGTTGAGCACCAGCCGCCCCACCGGCTGC
AGCGGCACCACGTCCTCGGGCCACGTCTTGGTCACGTCCAGCGGGTCGAAGTCGAACCGCTCCTCGTGGTCCGGGTCGATGGTCTGGATGTAGAAGGTCC
ACTCCGGGTAGTTGCCGGCGGCGATGGAGTCGGTCAGGTCCTTGGTGGCGTGGCTGTGGTTGGTGCCGCCCACGGTGACCGCCTCGTCCTCGAGGAGGGA
CTTGACGCCGCAGGTGGGCTTCCAGTGGAACTTGACGTAGTGCGCCTTGCCGGCGCGGTTGACGAGCGTGTAGGTGTTGACGCCGGAGCCGTCCATGTGG
CGGTAGTCGGCGGGCACGCCCACGTCGTCGAAGAGGAAGGTGAACATGTGGAGCGACTCCGGGTGGTGGGAGAAGAAGTCGAGGATGCGCCAGTTCTCCT
GGATGTGGGTCTTGGGGTTGGGCTTGAGCGCGTGCACCATGTCCGGGAACTTCATGCCGTCGCGGATGAAGAAGACGGGGAAGTTGTTGCCGACCAGGTC
CCAGTTGCCCTCCCGGGTGTAGAACTTGATGGCGAAGCCGCGCGGGTCGCGGAGCGTCTCGGGGGAGCCGCGCTCGTGGATCACGGTGGAGAAGCGCACG
ATGACGGGGGTCTGCACGCCGGGGGCACGGAGGAAGTCGGCGCAGGTGAGGTGGGACACGTCGTGGGTCACCTCGAAGAAGCCCTTGGCGCTGGCGCCCC
GGGCGTGCACCACCCGCTCCGGGATGCGCTCGCGGTCGAAGTCGGCGATCTTCTCCACCAGGTGGTAGTCCTCCAGCAGGATTGGGCCTCGGGATCCGAC
GGTGAGGGAGTTGTCGTTGTTCCAGACGGGCGCGCCGGAGTTGGTGCTCCACATCGGGGCGTTGAAGGAGCTCGACGGCCGGTACTTGTAGGGGTCCATG
GCGAATCGGAGGAAGCAACGATCGATCGACTCGACGGACGGCCGGCGGTGCGCGCGCGC
page-top