Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24309  (registered. 2003)
Contig Information
Length 1364 bp
Clones 27 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 5
Wh_EMC Dormant seed with cold treatment after water absorption 6
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMP Shoot grown under continuous light 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 5
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 2
Homology (BLAST) Top Hit 60S ribosomal protein L37 [Zea mays]
Score 466
Evalue 2.10491e-44
Total Hit Count 396
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24309
TCATATTGAAACAACAAAAAACAGACTCGTCACAAATAGCACATTGAACAATAGATGCAGCATNTAACACAGGACATCGACACAATTCAACATTCAAAAC
TGAAGGATTAACGTCCACGACAATTGTGCAAATAACATAACCAGGCATCATATAGTCTGCCTCTCAACATAGAAACATAAGAGTTCCAGTAGAAAACAAC
AAAAAAGCTAAGTTTGATGATCAGGGCTTCGCTTAGGGCAACAAATGGAGACTGTCACGCCTAGTTGCCGCTGGAAGAGGCTCCCTTGCTCCTTGGTGCG
GCCTCAGTTCCCTCTCTGAAGTTGCTCTTGAACCTCCTGGGCACATGGCGCATGTACCTCATCCTCCCGGTGCCGGTGGTCTTCCTCCTGATGGCCTTCA
CACTCCAGTTGTACTTGCGGATGCGGGCGGCGGGGTAGCCGCACGAGGAGCAGGTGCTCTTCTGCAGGTGGAAGCTGCGGCGGCCGCAGCGGATGCACAG
CGTGTGGGTCTTGTTCCGGCGCTTGCCGAAGCTGCCCGTTCCCTTCGTCATTTCGCCTTCGCCTGTCGCCTCGTGCCGAATTCGGCACGAGGCTCATCTT
CTCATCCCACCAAGACCACCGAGATCTCGTCTTCACATCCAAGCGGCGCGAGCAAGGGAGGAGACGCGCTCGCTCGCTCCACCGTCAGCAACCAAGCCAG
GCAAAGGGCGGCGATGACGTTCGACAAGGTGGAGGAGCTCCGGCCGGGCACCTACGGCCACAACCTGCAGCTCCGGGTGCTCAGCGCCAAGCCCGTCGTG
CTCCACAGGCCGCAGGGCGGCCGGGCCGGCGGCAACATGCGCATCGCCGAGTGCATCGTCGGCGACGACACCGGCGTCGTCGTATTCACCGCACGCAACG
AGCAAGTGGACATCATGAAGCCCGGGGCGGTCGTGGAGGCGAGGAAGGCGAGGGTGGACATGTACAAGGGGTCGATGCGCCTGGCGGTGGACAAGTGGGG
GACGCTCAAGGCTGCTGAGAGCCCCGCGGACTTCAAGGTGAAGGAGGACAACAACGTGTCCTTGGTCGAGTTTGAGCTCATCACCGTGATGCAGTGATTG
AAGAGGGCTCCTCCTCCTCGCCTAGGAGGAGGAGGAGGAGGCAGAGGAGGCTCAGCAGCTGCTAGGCTGAGCACAAAGCAATAAACCGGCCAAAATCATG
GCTCTTGTTCTTCACCCCCCCTTCCCCCTCTCTCTGTTTACTGTTTATTTGCTGGAAGTTTTGCTAGTCCTGCTACCTTTGGATTAACTGTCATTAGTAA
TACTATATATGTTTGTGAGGAGTTGCATCCAGATTGTTGTGAGTGAGTCCTGCTATATCCCTTT
page-top