Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24300  (registered. 2003)
Contig Information
Length 1947 bp
Clones 27 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 3
Wh_KMP Shoot grown under continuous light 4
Wh_PCDAM Anther at meiosis 6
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 4
Homology (BLAST) Top Hit Os02g0626100 [Oryza sativa (japonica cultivar-group)] >gi|110815839|sp|P14717|PAL1_ORYSJ RecName: Full=Phenylalanine ammonia-lyase >gi|48716258|dbj|BAD23794.1| putative phenylalanine ammonia-lyase [Oryza sativa Japonica Group] >gi|48716546|dbj|BAD23149.1| putative phenylalanine ammonia-lyase [Oryza sativa Japonica Group] >gi|113537012|dbj|BAF09395.1| Os02g0626100 [Oryza sativa (japonica cultivar-group)] >gi|125582942|gb|EAZ23873.1| hypothetical protein OsJ_007356 [Oryza sativa (japonica cultivar-group)] >gi|215735010|dbj|BAG95732.1| unnamed protein product [Oryza sativa Japonica Group]
Score 2487
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24300
TCGTGCGCATCAACACCCTCCGTCCAGGGCTACCTCCGGCATCCGCTTCGAGATCCTCGAGGCCATCAACAAGCTGCTCAACACCGGCGTCAGCCCCTGC
CTCCCGCTCCGGGGCACCATCACCGCCTCCGGCGACCTTGTGCCACTGTCCTACATCGCCGGCCTCATCACCGGACGCCCCAACGCGCAGGCCACCACTG
TTGACGGGAAGAAGGTGGACGCCGCCGAGGCGTTCAAGGCCGCTGGCATCGAGGGCGGCTTCTTCAAGCTCAACCCCAAGGAGGGGCTCGCCATTGTCAA
CGGCACGTCCGTGGGCTCTGCGCTCGCGGCCACGGTGCTGTTCGACTGCAACGTCCTCGCTGTTCTCTCCGAGGTCCTGTCCGCCGTCTTCTGCGAGGTG
ATGAACGGCAAGCCCGAGTTCACCGACCACCTCACCCACAAGCTCAAGCACCACCCGGGCTCCATCGAGGCCGCGGCCATCATGGAGCACATCCTGGCCG
GCAGCGCCTTCATGGGCCACGCCAAGAAGGTCAACGAGATTGACACGCAGCTCAAGCCCAAGCAAGACAGGTACGCGCTCCGCACGTCGCCGCAGTGGCT
CGGCCCCCAGATCGAGGTCATCCGGTCTGCCACCAAGTCCATCGAGCGCGAGGTCAACTCCGTCAACGACAACCCCGTCATCGACGTCCACCGTGGCAAG
GCACTCCATGGCGGCAACTTCCAGGGCACGCCCATCGGTGTGTCCATGGACAACACCCGTCTCGCCATCGCCAACATTGGCAAGCTCATGTTCGCGCAGT
TCTCGGAGCTCGTCAACGAGTTCTACAACAACGGGCTGACCTCCAACCTGGCAGGCAGCCGCAACCCGAGCCTGGACTACGGCTTCAAGGGCACGGAGAT
CGCCATGGCTTCCTACTGCTCTGAGCTCCAGTACCTTGCCAACCCGGTGACCAACCATGTCCAGAGTGCTGAGCAGCACAACCAGGACGTGAACTCTCTG
GGCCTTGTCTCGGCCAGGAAGACCGCCGAGGCCGTGGACATCCTCAAGCTCATGTCCTCCACATACATGGTGGCGCTGTGCCAGGCCATCGACCTCCGCC
ACCTGGAGGAGAACATCAAGACCTCCGTGAAGAACTGCGTGACGCAGGTGTCGAAGAAGGTGCTGACCATGAACCCCACCGGCGACCTCTCCAGCGCGCG
CTTCAGCGAGAAGAGCCTCATCACCGCCATCGACCGCGAGGCCGTGTTCAGCTACGCCGACGACGCCTGCAGCGCCAACTACCCACTGATGCAGAAGCTG
CGCGCCGTGCTGGTCGACCACGCCCTGACCGCCGGCCCCGGCGAGGCCGAGAGCGAGGCCACGGTGTTCTCCAAGATCAACAAGTTCGAGGAGGAGCTGC
GGTCGGCCCTGCCGCGGGAGATCGAGGCCGCCCGCGTGGCCTTCGAGAACGGCACCGCGCCCATCCCCAACCTGATCAAGGAGAGCAGGTCGTTCCCCCT
GTACCGCTTCGTCCGCGAGGAGCTCGGCTGCGTGTACCTCACCGGCGAGAAGCTGCTGTCCCCCGGCGAGGAGTGCACCAAGGTCTTCCTGGGCATCAGC
CAGAACAAGCTCATCGACCCCATGCTGGAGTGCCTCAAGGAGTGGAACGGCGAGCCCCTGCCCATCAACGTCTGAAGCATCGTCCGTGCGACCGTGGAGG
AGAGGAGGAGGCTTCCAGAGTACATCCAAAAATAAGACGCTTAATTCGTTCGTGCATGTTCTTCTTCTTCAGTTCCTATCGCCTTTTGCCTTTCGTTGTT
CGTGCGTTGGTGTTGATCGACGTGTGGCCTTGTTGTTAATTGTGTAGCTGCTCTGCCGCAGCTTTACCTAAAGATATTATTGTCGTTGTATTTTGGGGTG
AATCATGCTAATACTATGTGGTTCTTTTTTTGCTTGTAAAAAAAAAA
page-top