Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24296  (registered. 2003)
Contig Information
Length 468 bp
Clones 27 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 17
Wh_OKCS Seed DPA5 6
Homology (BLAST) Top Hit RecName: Full=Defensin Tk-AMP-D4
Score 264
Evalue 7.39061e-22
Total Hit Count 225
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24296
CCATCTTGAAGGTCTTAATCTGTCATAGAACCCTCTCAATCTTTCACAGGAAAACTAGATGGATCGGTCCATGAAGGTCTTTGCGGTCGTCTTCCTGCTC
CTTGTGGCCACAGGCTTCCAGGGAGCGGTGCAGGTTGCTTTGGCGAGGGACTGTACTTCACAGAGCCACAAGTTTGTGGGGCTGTGCCTGAGCGACCGCA
ACTGTGCAAGTGTTTGCCTGACCGAGTATTTCACCGGAGGCAAGTGCGACCACCGACGTTGTGTCTGTACCAAGGGCTGCTAGATGGCCCGTAATCTTCT
TGCACACATGCTTCCGTGTAATAATAATAACTGCTGAATAATAAGACTAGATCTGCATCTATGCATGTATGATGCATATGTGAGTGCTACTCCTAGAAAG
TACATGAACATCATATAATCCGAACAAAGTTTCAGCAGGGAACCAGTTCGAGTTGAATAAAAAAAAAA
page-top