Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24191  (registered. 2003)
Contig Information
Length 920 bp
Clones 25 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_SHC Shoot grown with cold treatment 10
Wh_SHDr Shoot grown with dessication 4
Wh_VHS Shoot with heat shock treatment 6
Homology (BLAST) Top Hit meiosis 5 [Zea mays]
Score 540
Evalue 3.06639e-53
Total Hit Count 57
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24191
TTTTTTTTTTAATGGAAAAGGATGGATTTATTGCACTCAAAATGCCATAGATAGTGATATTACATGATAAAACAACAAAAATAAAAGAAATATATCAAGC
CACAAGATAGCATCAATCAAGAAAAATGCGCGGGAGGAAGAAATTTAGCCAAGAAACACCGATGACTGAAACTAGTAGTGGAATTCATTTGCCTTCTTGA
AAACCCCAGCTTGGGCAGAAGCAGCACCATCAGAGGTCACGGCCACGACGATACAGTCCTTCACCTGCTGGGTGGTAAATGGGAACTTCTTGTTCACAAT
GGAGTTGAGGTATGCAGCTGCCCCCTCACGTATCAGGGCGCCAATACCATCAGTTCTAGTGTTTGAGAGTGCATCATGCATATTTCCTAGCTTCTTGCCA
CCTATCATACTGCATGCAGCACCAAATGTCTTGCCGATGTTGCCGAGGGACCCAATAGCTGCAACTATAGCATCTGGGTGATTCTTCCAGTAGTCGCAGG
ATCCAATGAACCCATGCTTCTTTGGACTTGCAGGGACATCATGGGAAGGTGCACTTGGGGTGCTCGGTGTAGTGCCATAAGATGGCGTCGGTGTAGTGCC
GTAAGATGGCGTCGGTGTAGTGCCGTAAGTTGGCGTCGGTGTAATGCCGTAAGTTGGTGTCGGTGTAGTGCCGTAAGATGGCGTCGGTGTAGTGCCGTAA
GTTGGTGTCGGTGTCAGTGTCGGGTTGTAGCCTCCTCCTGACCCATGCGTGGGAGTTGGTGAGCCCCCATAGTGGGTCTTCTGCTCATGCAACTCTCCCA
GGCTCCTGCACGAGCTCAGTGAAACAAGCCCCACCAAGACGGCACTCATCAGAAGAACCTTGCCACCCATATTGCTCTCAGTGTGTGCAGACAGGACAGA
ATAAGCAACTGAACTGAAGT
page-top