Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7762  (registered. 2012)
Contig Information
Length 886 bp
Clones alternative view 39 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 2
Wh_yd Spikelet at late flowering 1
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHDr Shoot grown with dessication 4
Wh_VHS Shoot with heat shock treatment 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XA Root 5
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|52548254|gb|AAU82114.1|| cytoplasmatic ribosomal protein S13 [Triticum aestivum]
Score 298
Evalue 7.00E-79
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7762
TTTTTTTTTTAAATTCGAAAACACTCAAGTATTTGAATGCTGAACTAGAGGCCTAGTTCAGAGTACTTCTAAACCGCTGAGTAAGAGCAAAGCAAGCAAA
GTATACGATCTTCAGCCGAAGAGCAACATGTACTATTGGAAAAAACATACGGTAACTGCTAACTGTAACTGACAAAATCTGGGCACATTATAACAGTCGT
TTAACAGACAGAACAGTGAAACCATAAAGGTTTTACAGCATCCTCCAGGCAAACATAGAAAATTTGCAGCATCTGCTTGGCTCCAAACTCTCATAAAGCA
TTACATAAGAATGGTTTCCAGAACAATCAAGCTTTAATCAGCTAAGAGCACACCAGATCTGGATCTCCCTTAAGCCACCAGAGTGCTGGCGGTGGTAGAC
TCGTACTTCCAGGTGGGCGGGAGCTTCTTGGTGCGCTTGTAGTAGCGAGCGAGGCGGTGGATCCTGCTCTCCACAAGGATGAGCCTGAACTTAGAGTCCT
TGTCCTTCCTGTTCCTCTCCAGGTGCTTCCTTATCGCCACCGCCTTCTTGATCAGAAAGTAGAGATCCTCCGGGATCTCTGGCGCCAGCCCATGGGCCTT
GAGGATGCGGAGGATCTTGCTCCCGGTGACGCTCTTGACGAGGGGGATGCCGTGCTGGTCACGGAGCAGGACGCCGATCTGCGACGGCATCTGGCCCTTC
TTCGCGGCCTTGGTGATTAACTCGTCCACATCGGCGACGGCGGTCTTGACCCAGCTTGGTGGAGTCCTCTTGTACGGCAGCGCTGACGACGAGATGCCCT
TCCCGCGGCTGTGCATGCGCCCCATGGCTGCGGCTGCTGCGGCGGCGAGGGGAGTGGCGGCGGCGGCGGTGGCGGCGGGAAGGGCG
page-top