Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7759  (registered. 2012)
Contig Information
Length 1822 bp
Clones alternative view 24 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 4
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_SP 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|170791250|gb|ACB38287.1|| apyrase [Lolium perenne]
Score 694
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7759
AGTGTCATCTGGTAATCAGTCTGTTGATCCCTCTATCCTTGCACTTGCAATTGTTCTTTACAATGATTCTAGACATGGTTAGACAGAGATAAATAATATG
TCCGACTGTTATGTAAGATATTATGTTACATAAATATTATAATATTTTTCTGCGAGAGATATATATACACACACATTATAATAGCTCGTTAGTTTTTTTA
TGAGATAGGGCCCTATTTTTTAGTTTCGCACAGGGCCTCAAATTTTGCCGGCCCAGCCCTGGCTGTGTGTGTGCGCGTGTGGCGTGCACATCTATATGTC
GTTGTACTCCTACACATTAGACTAGGCAATTCTCGCCACAAAGATGATAAAGGGATTACAATTGGAGATGGCGTCCAAGCATATGCACCTTATTGCAATT
AATCGTATGATACACATGCTTGCACCTTATTGTGAGGGATTGGCAATTATATCTAAAATCATGCATCGTTGAGCCGCTTGGTGGGTGAGACGGCCTCGAT
GGCTTCTCCGAGCGCCCATGCGGCTTCGATGAAGTACTCCCCATGCTTCACCTTCTGCGCCACCGTGATTTCCTTGGTGGGCTCCAGGCCGAAACCGTCC
ACGAGCAGGGAGTACTGGTAGACGAGGTCCATGCAGATGTAGGGCGTGTCGACGGATCGCACCTTGGGGTACGTGGCCTTGGCTTCCATGAAGCCCATCG
GGCAGATCTTCTCGGCGGCGGCCCTGAACGCCGCAGGGGTGGTCTTCCCGCTTGTGGCCTCACTGTCGATCAAGCCAACGTCTGCTGCCATGTAGTAGAA
GCTGGAGGTGACGTAGAGGTCGGCTTGGCCAGGGCCGCCACCACCATTCCATGCGCCGTTGAAGGTGCAGTTCTTGGCCTGGCAGGGCGCGTTGATCTTA
AGCGCCTTGGTGACATCCTCTCTGCACTTGTCGTATGCTGCTCCTTGAGGAGGCGCTATGGCGTCATATTGCTCTCCGTTATAGGTGTATTTGCCATTGT
ATCCCCGCAGCATGCAGTAGCTCACTGGACCATTCTTGGCCTTGAAGATCTCTACCCGAGAAGCCATTGCGCCATAGTGCAAGTAGCTGTGAACATAGAC
GTTGTAATCTCTTCCTTTGAGATACTCTTTGGTGACGTATGGATCGTCCCCTTGAGGCACCCCGGGAGCGGTAGCGGCGGCATCCGCGGAGATGGCATAT
GCCATCTGCACTGACCCGCCTCCAAGGTCGATCACACCCACCGTCTTGGAGTAGTCTCCTCCTAAATTACCCAGCAGGTAATTCAGAGCAACCCACAGGT
AAGACCCTTCCTGAGACCCCTTGAGGACATTGATCCAACTAGGATTGTACTGGAATTTGCTCTGGCTGTGGACAGCATCCCTCACTGCTTCAAGAATTTG
CTCTGCTTTCTCGTCTCCGATGAGCCTGAGCCCAGCCGTCGCCCCTAGTTTAACGGGCGTTTTCTTCATGAGCGAGCGAGGCACGGTGCTCTTGGCCTTC
TCGAGCAGAGGCACGATGGACTTGGCCGCCTCCTGCGGCCGGCCGGCGTACGCGCTCAGCCCCGGCTCTACCTTGGCGAAGACCTCGATGTCGTCGCCGT
CGCCAATGTCGATGAGCTCCATCTTCTTGTCGAACCGGAAGACGTGGACGCGCGTGCCCGTGCTGCCCGCGTCGAAGATCACCGCGTACTTCCCGGCCGC
CTTCTTCAGCTCGGGCTCCTCCTCGGTAATGGTGCTAATACCGGCCTTCCGGCCGAGCACCGCCACGTCGGCGGCAAAGGCCGAGCCGGCGAGCGAGAAG
GCCACGAGGAGGATGAGGAGGA
page-top