Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24136  (registered. 2003)
Contig Information
Length 891 bp
Clones 24 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 6
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_OKCS Seed DPA5 6
Wh_SHC Shoot grown with cold treatment 3
Homology (BLAST) Top Hit ribosomal protein L6 [Triticum aestivum]
Score 1033
Evalue 1.96787e-110
Total Hit Count 335
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24136
CAACAAGCCAACAAAGGGGATGGTACTTCCTAGTTATCTTCTCAAAATATTTGACAGGCAGACTTCAGTGGAAATCAAATATTCACCAACCAGGCAAAAG
AAATCAGAAGTACAGAACCAGAACACACACTAGACAAAAAAGACTTCCACAGATCTTGAAACTTGTACCAGGTAACTTAGAAGGTCATCTCATGCGGCTT
GTCGCCATCCCTGAGGGAGAACCGGGCACCAAGATAATTTTTAAGGTCTGGGACAGCATCGATAGCCTTGATCAACTCAGCGTCAATGACCTTCTGGTCA
TCCTTCTTGAAGTCTGGCAAATTCTTGGTTGCCTCCTTATCCGACTCAAATAGCTCGCCCTCAGTCTTCTTTGCCCTAGTCTTCTTCTCCCTAGCGAAGT
ACTTGTCATCAAACTTCTGCACATTAACCTTAGAGATGTCGACCTTTGTGGATGTGGCAATGACGTAAGCCTGGTTCACTCTGCGGATTGGCACGCCATT
GATCTTGAAAGGTCCAGTGATGAGGAGAAGGCCGGACTGGAGCTGCTTGAGGAACACCACGCGCTTTCCCATGTACCTCCCCGCGAGCAGGATCAGCACC
GTGCCCGGTGTGATGGTCGATCTGAGCTTGGTGGGATGGGGCTTGCGTGTGCTCACGGTGCGTGGCTTGACATCATCAGCGGGATAGAACTTGGGCTCGG
CGACGGCGGCCGGCTTCTCGGCCTTGGGCAAGGCGCCGCCGTGCTTGGCCTTGATGGCCCAAAGCCCGCGGCGGTGGTAGGTGTGCGATCTCGACGCCCG
CTTTATGCCGAGCGCCATCTTCGACGTCGGAGCCATTGGTGATTCTTCGGTGGACGCGGAGCGGCAATCCGGCGAGAGGGGGCAAGGCGGC
page-top