Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24128  (registered. 2003)
Contig Information
Length 991 bp
Clones 24 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 3
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit Os04g0605900 [Oryza sativa (japonica cultivar-group)] >gi|113565368|dbj|BAF15711.1| Os04g0605900 [Oryza sativa (japonica cultivar-group)] >gi|215707011|dbj|BAG93471.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218195518|gb|EEC77945.1| hypothetical protein OsI_17293 [Oryza sativa Indica Group]
Score 917
Evalue 1.55712e-103
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24128
TGACAACAATAAGAAACGTATTCGCGGAACACAGCAAGAGGCATTAAACACGGTCTCAAAACCTCCACATACATAGTCACATTCTTCCAAAAACATGCAT
CATGGTTCCGAAATATCAAAACTGCATCCACCATCCACTTCCTAATGTAAAGCAGGCTTAACAAACAAAACATCTTCCGAATACAAGGGGATCATCGATG
ATCAACCTAGTTCATCCTCCTGACGAGCTGGTTGATGTAGTTCTCGCGGTTGCCGGCATCACCGCCCTCGACGTAGTGGTTCCTCTTCTTCTTGAGGCCT
CCCAGCGGCGCCTTCAGCTTGAATGGCCACAGGAAGTTGTTGGCCTCCTTGAAGTGAGGGCCAACGGTCAGGATCTCGTGGACAAGGTCCTCAATGCAGA
TGATGTTGTGCTTTCCAAGACCCTCCTCGATGACCTTGTTGTTGGTCAGAGGAATCCTTTGCTTGTTGAGCTTTCCATAACCTCTTTTGTAGATCAACTC
CCTCACACTCTTCAGGTTCGGGTACCCATATGCAACATATGGCTCGACCCTGCGGAGCATGTTGATGGTGGCCTTGTTAACCTTCAGGAACACTCCATTG
AATATCTGTCTCAAACGCAACAGCTGCAAGATCTTCTTGGTCTTTGGGTGCATGGCATTGATACCTCTGATTCTGACAACAAACAGCAGCTTAGCCTCAG
GACTGACATAGAACCCACCCTTCATCCGGGCCTCACGCTTAAGCTGAACCAACTCCTTGTCCTGGGCATCGTACTCCTCGGCGTACTGCTTGGCGCGGGG
CGTAGATGACCTTGACGTTCTCGCTGGACTTCTTCTTCTCCTCGACGGCCTTGGTCTTCTTCTCGGCGGCCCAGAGCTCCTCCCGCTTCCTCTTGAGGAG
CACCGACTCCGGCACCACCACCTTCGCCGCCTCGGACGACATCCCGACGAGCTTCCTGCAGGGGGGAGGAGGAGGCGCGAGAGAGAGGAGA
page-top