Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24122  (registered. 2003)
Contig Information
Length 865 bp
Clones 24 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 9
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 6
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 2
Homology (BLAST) Top Hit Os03g0358100 [Oryza sativa (japonica cultivar-group)] >gi|11544696|emb|CAC17628.1| putative phospholipid hydroperoxide glutathione peroxidase [Oryza sativa (japonica cultivar-group)] >gi|108708259|gb|ABF96054.1| glutathione peroxidase, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113548616|dbj|BAF12059.1| Os03g0358100 [Oryza sativa (japonica cultivar-group)] >gi|125543925|gb|EAY90064.1| hypothetical protein OsI_11636 [Oryza sativa Indica Group] >gi|125586318|gb|EAZ26982.1| hypothetical protein OsJ_010465 [Oryza sativa (japonica cultivar-group)]
Score 824
Evalue 3.22848e-86
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24122
TTTTTTTTTTGAGCCCAAATACAGAACTACCATAAACTGCATACGATTCCAGTTCATCAATAGCTCGTGTACCTCGACAAAAGCACCCAAAACAGATAAA
TAATTGATAGCTACACAACCTCTACTTACATAAGAGGAAGTCACAAATACAAGAACAATGATCAAACCAGGGGAAATATCACATTAATTTACTGGCAGAG
ATTGGTCTAGATATTACAACGGGGATACTTTGCAAGTGCCTACTTCTGCGAGTCAGAAGATTCCTCCTCCTTTTTTGTCTGCGACTCGGAGGGTTCCTCC
TCAAGTGCCTTCTGGATGTCTTTCTCGAATGAAAATGGAGTGGTAGCAGTTGCGTATCTGTTGATTACTTTCCCATTCTTGTCAACAAGAAACTTGGTAA
AGTTCCACTTGATTCTTGAACCAAACAAACCAGGTTTGCTAGCTTTCAAAAACTTATAAAGCGGCGCAGCATCTGGGCCATTTACACGCACCTTCTGAAA
AACTGGATATTCAGCTTTGAATCTTGTGCATGCAAAGTCTTGGATCTGCTGGTCACTGCCTGGCTCTTGTCGCAAAAACTGGTTGCAGGGGAATGCTAAT
ATCTCAAAGTCTTTCTCCCTGTACTTCTGATAAAGCTCCGTCAGTTGCGTGTAATTAGTCTCCGTGAACCCGCATTTGGAGGCGACGTTGACGATGAGGA
GGACCTTCCCCTTGTACGTGTCCAGGCACACCTCCTTGCCGTTGCAATCCTTAACGGTGAATTCGTGCACGGAGGTCTCCGGCACAGATTCGGACGCCCC
CATCTCGCCCTCTCTTCGCCTCCCGGACGGCGTAAGTCCTCCCGAATCCTCTGTCGAATTTTATC
page-top