Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24086  (registered. 2003)
Contig Information
Length 1406 bp
Clones 24 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 1
Wh_EMC Dormant seed with cold treatment after water absorption 5
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 2
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195620520|gb|ACG32090.1| pyrophosphate--fructose 6-phosphate 1-phosphotransferase beta subunit [Zea mays]
Score 1839
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24086
TTTTTTTTTTCAGGGGTAGGTGGGGGTTTGATATATGGGGAGCAATCGGGTCATAGAAAAGCTAAAATTAGTTATTACGACATCCACTGAACCCACTCCA
ACTCAACCTCTTATTAAACATTCCACAATGCGGAGACTGCCGCTCCGCTATGGGAGTTTGTTCTCCACTCTCAAAACTGCAAGGAAGAAGTAGAAAATTT
GAAAGAAATACACTCTACACCGCCGCCTCTATATCTCAGCGCCAAGCTCCAACATCAAGGTATGGTTCGACGCATCGCTTCCAGGGCCGCTGAACTGGAT
GGGACCAGGGCTGATGTATCGGTTCTTGCTGGCCCATTCATCTCGCAGCGAGGCAAACTTCTTAAATGGCGCAGCATCAAGTTCCACCATAGCCTTCTTG
ATCACTGGCTTGTTCTTGCCATGCCTTCTCTCAACATCCATCAACGCAGTCAGTGCAGTTCCTCCAACAGTCCATTCTTCCACAGGAGCAGCCAGGTTAC
CAACCGACGAAATAAGTCCTGTCTTGCCAAATTGGAGAAGAGCACCAGCACCATAGCCTAATGCATAGCAATAGCTGGAATCAAAATTGGTAGGGAGGCC
GCATCTTCCTTCATATCCGAAGAAGTGAGACTGGCCTCTGAAATGTGCAGAGTACTTCCCCGCCGCTCTTCTCTTCTCCAATTCAGTTTCAACCATGGCA
ATAAGCATTTTCTCAGTTTCAATTTTTGCAACCTGAACATTGCCATGGGGATCTCTTTCAAGCAAAAGCTGCTCCTGAATGGTTTTGGGCAAGAAGTCAA
ACAACTCCCTAGATGCTGGTTCAAGCTTGCTTTTCCAAGCCCCTGCCTCGTCAACAACATCATGTGCCAAAATTTCATTCAATTCTGCAATGAGTTTTTG
AATCTCTGGGATGAAATCAATCAGGCCTTCCGGTATTAGGACAACTCCATAGTTGTAACCAAGTTCTGCACGTTTGCAAACAACATCGGTAATGTAGTCT
GTGACATTCTTGAGTGTTTCCTTCTTCTCAGCAACCTCTTCACCGATGAGTGCAACATTAGGGTGTGTCTGTAGAGCACACTCTAGTGTAATGTGAGAAG
CAGCACGACCCATAAGCCTCACAAAGTGGTAGTATTTGCCTGTTGACCGTGCATCAGTCATGACATTGCCAATCATTTCGGAGTATATCTTGCAAGCAGT
GTCAAATCCAAAGCTTGTTGGGACCTCCTTGCATTTCAGATCTCCATCAATAGTCTTTGGGCAACCAATAACGCGAGTCTTCAAGTTCCTTCCCCTGAAG
TATTCACCAAGGAGGCATGCGTTAGTGTTTGAATCATCACCACCGATGACAACAAGTCCATCCAAATCAAGTCTGTTGACTGTGTCTTCAGCTTGCTGGA
ACTGCT
page-top