Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24084  (registered. 2003)
Contig Information
Length 1406 bp
Clones 24 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHDr Shoot grown with dessication 6
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 4
Wh_VWD Shoot grown with dessication 4
Homology (BLAST) Top Hit Os01g0501700 [Oryza sativa (japonica cultivar-group)] >gi|13442818|dbj|BAB39766.1| OsTATC [Oryza sativa Japonica Group] >gi|15408654|dbj|BAB64068.1| putative TatC [Oryza sativa Japonica Group] >gi|113532664|dbj|BAF05047.1| Os01g0501700 [Oryza sativa (japonica cultivar-group)] >gi|215695165|dbj|BAG90356.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218188286|gb|EEC70713.1| hypothetical protein OsI_02087 [Oryza sativa Indica Group]
Score 1057
Evalue 3.92808e-133
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24084
CTGGCGGAAGCGAGCAGAAAATTATCGGTTTATCACCTATCGAGCTCCCGCGAGAGACGATGGGAAGCGCAGGAGCGCTGCTCTCCCACCCCCCACCGCA
ACTCGGCAGCATCCTCCTCCGTCGCCACCACATCTCTCTTCCCCATCTCTCCTCATGCATGCCCGAGCCCCTCCACTGCCGCCGCCGGCACCTTCGCTGT
TCCGCCGTTGAGGGGAGCAGCAGACAGGACACGAATTTGCCAGCGTCTCAAAGAGAAGAGTCTCCATCGAGCAGCCTCGGCGCCACCCTCCAAGATCCAC
TTCCAGGACGTGCTCAAATGTATCTTGTACAGTCGAAAATGGTTCTTTTGAAGGTGTCACACAGGAAGAAGATCAGAGTAGTCTATATAATTTTCTTTAT
CCAAGCAAAGAGCTACTTCCAGATGATAAGGAAATGAGTATATTTGATCATCTAGAGGAACTTCGTGCGAGGATATTTATATCAGTATTGGCTGTTGGAG
CTTCAATAATTGGTTGTTTTGCTTTCTCCAAAGATATAATTAAGATTCTTGAAGCGCCTGTTAGTGTTCAGGGTGTCAGATTTTTGCAGCTCTCCCCTGG
AGAATTTTTCTTTACAACATTGAAGGTCTCTGGTTATTGTGGCCTCCTAATCGGAAGTCCTATAATTTTGTACGAGATCATAGCATTTGTTCTCCCTGGT
TTAACCAAGGATGAGCGGAAATTCCTAGGGCCCATTGTTTTGGGTTCTTCAGTTCTGTTCTACCTTGGCATTTTATTCTCCTACACTGTTCTTGCTCCAG
CAGCATTGAACTTCTTCGTGAATTATGCCGAAGGAGCGGTTGAATCGATATGGTCAATAGACCAGTACTTTGAGTTCGTACTTGTGCTTCTGTTCAGCAC
AGGATTATCCTTTCAGGTTCCTGTGATCCAGCTGTTGCTGGGGCAAGTTGGACTGGTTTCCAGCGAACAAATGCTTTCAATCTGGAGGTATGTTGTTGTT
GGTGCGGTGGTTGCTGCGGCTGTGCTTACGCCCTCGACTGATCCCTTGACTCAGATGCTTTTGGCGGGTCCACTGCTTGGTCTGTACTTGGGTGGTGCGT
GGATGGTCAGGCTAACTGGGCGCTAACTGCAACAAGCGTTGTAGTGATTGGGTATTGTGTGTTAGTGTACTAGAAATCATAGCCGTGTTGATTGGTCCGA
GTGGTCACCGTCCCCCACTGTAACATAGTCTTGTATAAAATTAACTCGGCTGCTTCTCATCTACGAGCACATTATTTGGCCCTCTTTCTCAATAGCGTGG
AGGCCATCTGTGAAGCCAGTATGACTATACCTTGCCGAAGTATTTGCAACTCTATTCTGACTATGAAGAGTATCTTGCTGAAGCATTTGCAACTTTAAAA
AAAAAA
page-top