Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24076  (registered. 2003)
Contig Information
Length 1451 bp
Clones 23 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 2
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 1
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195639356|gb|ACG39146.1| transaldolase 2 [Zea mays]
Score 1824
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24076
TTTTTTTTTTACACAAATATGGCTCACTTGCTCAAAAACAATTGATCAGAAAACGATAGCAGTTGCGAGCAACAAACCTCAGTTACACAATGACAGCCAG
GCACGCCTAGAATACAAAGAAGCTCACCCAGATAACTGGGAGCATTTCATTTCCGAATGGAAGGGGAGAGCCAGCAAGCTGGCATTTTTATTGGGTAATC
GTTTGATGGCCAGCGCCGGTACCAAACCATTCTATCCAACAATTTTAGCGCCTACAGGTTGGCGGCGGTCTTGAGGGCATTGCCCTTCTCCTCCAAGCTC
GTGAGCAGGCTGTCGAAGCTCCCCTTGAAGGAGCTCACGCCCTCGTGCTCCAGCTGCTTGCCAACCTCTTCCCAGTCGATGCCCAGCTTCTCCAGGGCAC
TGTATATGCCCTCAGCTTCTGATACGTTCGCGTCGATTGTCCTAGCAACTGTGCCGTGGTCGATGAACGCGTCCAGAGCTTGGTCGGGCATCGTAGAGAC
GGTGTCAGGTCCGATGAGAGGATCGACGTAAAGAGTGTCCAAGTAAGCCGGGTTCTTCACGCTGGTGGATGCCCACAACAACCTCTGCTTCTTGGCTCCC
TTCTTCACCAAAGCCTCCCACCTCGGGCCAGAGAATTTCTTCAGGTAAAGCTGATTTGCTATCTTTGCTTGTGCTACGGCAGCCTTTCCCCTCAGGGCAA
GAGCTTCCGGTGTTCCAATCTTCTCAAGCATTTTGTCGATCAGACTGTCAACTCGGCTGACAAAGAAGGATGCTACACTGGTTACTCGGGATAAGTCGCT
CAAACCAGAAGCCTCAAGCCCGTCGAGGTAAGCATCAATCACAGCCTCGTATCTTGCAACAGAGAAGATAAGAGTGACATTGACGCTGATGCCATTAGCA
ATGACTTCCTTGATAGAAGGAACACATTCTGCTGTAGCTGGGATCTTTATGTACACATTGGGGCGGTTGACCACTTTGTGTAACCACTTCGCAGCTTCGA
CGGTTCCTTGGGTGTCATTTGCCAGCCTAGGAGACACCTCCACTGAAACGTAACCATCAGCCCCATCAGTCTCGTCGTAGATGGGCTCAAACAGCTTGCA
CGCGTCTTGGATGTCCTTTATGACGAGTTCCCAGTAAGCGCTCTCCGCATCCTTCCCAGCTGATATAAGCTCCTTGAACTGACCGTCATAGGCGTTTGAT
GAAGAGATGGCTTTCTGGAAAATCGTTGGGTTGCTGGTGACTCCACGGACACCGTTGGCGATGTAGGGCAGCAAATCGGTGACAGGCCGGCAAAGGTTGT
CGTACCACGGGGACTGACCCTGTTGCTCATAGAGGTCATGGAGCGTGGTCCTCTTCGTCACCGCACCGTTCCCTTCCTTGGCGGAAGCCATCGCAATGAC
GGGGCTCCTGGCGCGGCCGGCGAGGGAGACGCGGAAGCGTCGGGCGGAGGG
page-top