Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24073  (registered. 2003)
Contig Information
Length 831 bp
Clones 23 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_PCDAM Anther at meiosis 4
Wh_SHDr Shoot grown with dessication 2
Wh_VSCB Liquid cultured tissue 6
Wh_VWD Shoot grown with dessication 4
Homology (BLAST) Top Hit Os08g0366100 [Oryza sativa (japonica cultivar-group)] >gi|38637102|dbj|BAD03357.1| putative ethylene-responsive transcriptional coactivator [Oryza sativa Japonica Group] >gi|113623616|dbj|BAF23561.1| Os08g0366100 [Oryza sativa (japonica cultivar-group)] >gi|125561308|gb|EAZ06756.1| hypothetical protein OsI_29001 [Oryza sativa Indica Group] >gi|125561310|gb|EAZ06758.1| hypothetical protein OsI_29003 [Oryza sativa Indica Group] >gi|125603185|gb|EAZ42510.1| hypothetical protein OsJ_025993 [Oryza sativa (japonica cultivar-group)] >gi|215692743|dbj|BAG88163.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215767745|dbj|BAG99973.1| unnamed protein product [Oryza sativa Japonica Group]
Score 655
Evalue 1.18436e-66
Total Hit Count 445
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24073
AAATATCTTCCTCTCCTCTGTCCTGCGCCTCCATTATCCCTTGCGTGGTTTTAGTCTGTGAACTCGAGAGACCGAGCGAGGAAAGTTGCCGTGTGAGACC
TGAGAGTCAGGGAGATATGGCTGGGATTGGTCCTATCAGGCAGGACTGGGAGCCGATAGTGGTGCGGAAGAAGGCGCAGAACGCCGCCGACAAGAAGGAC
GAAAAGGCCGTCAACGCTGCCCGCCGCTCCGGCGCCGAGATCGACACCACCAAGAAGTACAACGCTGGAACGAACAAGGCTGCATCTAGCGGAACTTCCC
TCAACACCAAGCGGCTCGACGACGACACCGAGAACCTTTCCCATGAGCGTGTTTCAAGTGACCTGAAGAAAAACCTTATGCAAGCAAGGCTGGATAAGAA
GATGACCCAGGCACAACTTGCTCAGATGATCAATGAGAAGCCACAGGTGATCCAGGAGTACGAGTCGGGCAAGGCGATTCCGAACAATCAGATAATTGGA
AAGCTCGAGAGGGCACTTGGAGCTAAGCTGCGTAGCAAGAAGTAATGCCTTGAAGTAGCCAAGCCCTGTTTACTTGCCTTGCATTACATTTGCTAGGTCC
TAAAAGCTTTTACAGGCTGTTCCTGTTGGTTGATACTGAATAACTATGCCACGGAACCACTTTATGTATCATTATATTCTCGTGTTCTAAAATGTGTCAG
TCATATGTCCCAGTGTAAGAGCTGCATTGAGCATGTAGATTGACATGATAACCTGCGTGGTTTATGTGTGGTGTTTGTTACTGGCTTTTGCTAATACAAG
TGTGTTGTGAGGTAATTACACAAAAAAAAAA
page-top