Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig775  (registered. 2012)
Contig Information
Length 877 bp
Clones alternative view 40 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_r Root 2
Wh_yd Spikelet at late flowering 4
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 6
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 4
Wh_VSCB Liquid cultured tissue 4
WH_SP 4
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|464640|sp|P35267.1|RL172_HORVU|RL172_HORVU RecName: Full=60S ribosomal protein L17-2
Score 348
Evalue 3.00E-94
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig775
TTTTTTTTTTAATTAAGAGCAACTAAAAAGTGGATATAATACTCAAAGTGAACATCCCGAAAGGACCAGCATCTCTGAGAAATAAGTTCTGATGGGCTAA
TGCTCAAATATCTGAAACTGTTTTAGCATATAAAGACCACTCGCGATCACAAGGATAGCATCAACCTTAACAAATCCTTACTCCATGTTGGTAACAAAAA
CATCAAGGAGGCAACAAACACTGCCAACAAAGATACTTGAGAAGAACTACAACTAAGATTCTTGGACGAATGCAGCCACTCCGTTAGCTTAGATAGCTTT
CCTTGGTGCGACGACGTTGTCAGCCTCCTTCTTCACAGGCTCTTCCTTCTCTGACAAGATCAGCTCAATGTGGCAGGGGTTGGACATGTAAGGATTGATG
CGTCCATGAGCACGGTATGTACGGCGCCTCTGCTTTTGGGCTTGGTTCACCTGGATGTGTGAAATGTAGAGGTTGTCGACGTCCAAGCCTTTAACCTCAG
CGTTACTCTCAGCATTCTTCAGCAAATCCAACACGAACTGGGCCGACTTTGCAGGCCAGCGACCCTGCCCATTTGGCTGGTGGTTCTTTACTTGCGCGGT
ACGACCCACACCTCTGCAGTATCTCCGGAAGGGAATCGCTTGCTTGTGAGCGAGAACATCCTCAAGGTACCTCTTAGCCTTGCCCAAAGGCATCCTGCGA
AGAGCAAACGCTGTCTCGCGTGTGTTCTTGAAGTGGACCCTGAGATCCTTGCCACAGGCCTTGGCCGACTTGGTCGGGTTGGACGGATCCCTCGAGTACT
TCACCATGGCGGCGGCGGCGGGGGTTGCGGCCGGAGAGGAGGGATGGGAGGGTGAGTGCTGGCCTTGGCCCTCGTGC
page-top