Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24066  (registered. 2003)
Contig Information
Length 1576 bp
Clones 23 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 6
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 1
Homology (BLAST) Top Hit proliferation-associated protein 2G4 [Zea mays]
Score 1676
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24066
TTTTTTTTTTAGTGGAACTTACTGCCGGATTTATAAGCATTACTGACAGGTAAACATTCAGCACACCATACATAATTATCAGGCTTGTACTTCGATGTGA
TGTGCGCCAGGATCAACCATTTTCATTAGACACTTCAAAAAAAGGTACTCAAATCCCCACAGCTGAATGTAATATAAAACAATCAGATGCAGCAAAGGAG
CAGGTACAAACGTAACGGAAGCAATTCAAAAAAAATGAGAATTATTCCTGGCTTGGTGCGTCCTTAGAAACCTCCATGGGCTCTGCTACTTCTGCTGCAT
CTCCTTTCTTGCCTTTCTTTTTCTTGCCACCACCCTTCTTCTTTGACTTTGTGCCCAAAGCCAGCCAAGCCTTGATCTCAGCATCGCCCTCGATGGATTT
TGAGGGCTCCAATTGCTGTAGTGGATGTGAAGTTATCTTGTCAGACCCATTTGGCATCAACAACACGGTGAACTTGATGTGGGCAACCAGGTCACCTTGC
TTCTCATGTAGAACAGGGTATGGCTGCAACAGCTCATGATTCATGCATTCTACCAAACCTAAGCGTGCACGCTTCTCCTCCAGCGCCCTAGCAGTGAATG
GCATGATTGGGAACTTCTGGCTAATCTCACTGAAGATGAACCTTGATGCCTTCATCTTCAAGTGATAGTTCTTGTCTACAGCTCTCTTGTAAATAGTGGT
CTGCTTCTCATCCAATAGCTTCGGCTTTCCCTCGCCAGTGCTGGTGACAATATCAATTGCATACACTTCATTTTCTTCAAATTCAGCATCATCCACCTTT
GTATCAGCATTTGAAACACTAAGTACCACTTTGTTACCATCGATGACGAATTGTTTCAGCTGATGGCTAAGAACTCCTTCAACAATTTTACAATCATAAG
CAGCAGCAACTTTCTGAATTGCTTCAGTGACATCCTTATTCTTCTTGCCAGGTCTAACAAGCCTCATTGCAACTTCTGCTGCTGTGTTTGCAGCAGCAAG
AACATTAGCTGCTCTTCCAGTAACCGGCCCACCTTTGATGACATGTGTATGAGCCACCACAGCAATAAAACCATCAATATGGCAAGCCATATCGATCTTC
ACCATGTCATTTTCTTCGAGTACAGAATCGTCAGTTGCCAGTGGGGAGAAATGACAGACTGTGTTGTTCACAGATACACATGTCGGGAAAGCAATGCCCC
TTTCAATCTTCCTCTTCACGTTCTTGTAGACATTCCCAGTTTGCTCTGTTATGAAATTGTCACCCTTCTCACAAATGTCAACAATCTTGGCTTTCGGCTT
GCACTCCGACAATACCAACTTCAGAGCCTTGTTGATGATCTCGGCGGCGGTCTTGTACTTGGTGACGACCTCGTTGGAGGAGAGGTCGAGCTCCTTCTCC
TCCCTGACCTCCTCGTCGGACGACATCGTTCAAGCCGGACGGGGGATGCGGGGCCTGGGGAGGGGAATCGGGCGGCGGCGGCGGCGGGAGGGCGGAGGTT
TTAGGGTTAGGGTTTGGGAGGGCGAGGGGTTTGGGGCTTTGGCGTCTCGGGAGGGGGCGGATTAGAATGGAAGCGG
page-top