Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24062  (registered. 2003)
Contig Information
Length 1022 bp
Clones 23 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 5
Wh_KMP Shoot grown under continuous light 9
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHC Shoot grown with cold treatment 7
Homology (BLAST) Top Hit Os05g0595400 [Oryza sativa (japonica cultivar-group)] >gi|55733879|gb|AAV59386.1| putative nucleoside diphosphate kinase [Oryza sativa (japonica cultivar-group)] >gi|57900667|gb|AAW57792.1| putative nucleoside diphosphate kinase [Oryza sativa (japonica cultivar-group)] >gi|113580066|dbj|BAF18429.1| Os05g0595400 [Oryza sativa (japonica cultivar-group)] >gi|215692731|dbj|BAG88151.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215694755|dbj|BAG89946.1| unnamed protein product [Oryza sativa Japonica Group]
Score 891
Evalue 7.24446e-94
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24062
TTTTTTTTTTGCAGAGAATATAGGCCTGAATTTGGACAACACATGAAAACAAACAGCATCCATCAAAATCAAGTGCCTGAAGGCGACGGTTTGATTTGAA
CATCACGATTGCTCGGTGCACGCTCTATAATATTCAAAGGTACAAGCTCTTTAAATTTCTTCGGGCCCTATTGCATCAGAACGAGACAAGGGCAAGGGCG
ACACCGACTGAAAGGTCGCCCGGGTCGCGGTGTTATTGCACTCTGCCATGGTCTAGACGCGATTACGGAAAGGGACTGGAGCTTCTTTGGCTCTTCTGAA
GACGATGCAGCGGTTAGTTCACACCGTAGATCCACTTCTCCTCGTTGCTGGTGTAAGAGACCAGCTCCTTGGGCTGGAACCAGAGTGCGATCTCGTCCTT
GGCTGTCTCCGGGCCATCGCTCCCATGGATGATGTTTCTTCCAACAACAACAGCAAGGTCACCCCTGATGGTTCCTGGCTCAGATTTCGATGGGTCCGTG
GCACCGATCAGCTTCCTCCCGTACTTGATAACGCCCTCTCCTTCCCATACCATGGCAAGCACGGGACCGGAGCTGAGGAAGTCGCACAGTCCACTGAAGA
AAGGTCTTTCCTTGAGATCATGGTAGTGCTTCTCGGCAAACTGCTTGGATGGAACCACCAGCTTGATGGCAACAAGCTTGTATCCTTTTCTCTCGAATCG
GGACACTATCTCAGAAATGAGGCCTCTCTGGACGCCGTCGGGCTTGATGGCGATGAAGGTGCGCTCCATCTCGGCGGCATGCACGTCCTGATCCTGGAGC
ATGTAGGCTGCGGCGGGGATGGCGGCGATCCATGCGTAGCCGTGGGAGGAGGCGTTGGTGTGGAGGTGGTGGGCGTATGCGGCGGGGAGGGTGGAGTTCC
TGCCGAGGTTGGCGAGGGTGGCGAGCGCGGCGTTCCTCCCGTCTGCGAGGAGGGAGGAGGCCGGAGCGGAGGAGGATGCGATCAAGGACCCTGGCGGCCT
TGCAGGCGGAGTGAAGAGCTGC
page-top