Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24058  (registered. 2003)
Contig Information
Length 1080 bp
Clones 23 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 3
Wh_RDr Root of dessiccated seed 6
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit proteasome subunit beta type 4 precursor [Zea mays]
Score 1060
Evalue 1.98521e-113
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24058
AAAGACAGGGTTTCGACTATGAAAGGGCAGCCAAAACAAGTCAAATGGAGCGCGGTTTGGGAGCAGGCACTGCACCCTCGGCCAGCACTCCAGATTGATC
CAGAGTGAAGAGGCATCATCATACAAGACATGATCTACCTTAAACGTTCACAAGACTTTAAGTCAAATTATAAACATGTCATACAAAGCAAATGTGGAGT
CCAGTCGTATTCAGATCAAACGCTCACAAGGGCTGAAACTGTTTCAGCAGCACAGTTTGCTTCGTTTCCTAGCTCATGGCCTTACCATGTTCCTACAGCA
CCCTTGGATGGGTTCTCAAAGGCGGCAAACCCCCAGTTGGTCTTCAGGGCATACGGCGGGTAGATGGTTGATCCCTCGGTTGTGATCTTGGCAATCTGGA
ATTTGTTGATGGATGACCGGTCACGGTACAGCAGGACCAGCAAGCACTTCTCAATCAGCTTAACAGCTTCTTCAAAAGTCATGTCCTCGCGCCATTCACC
ACGAAGTATTGGGATTGCCATATGGTTCCCAAATCCAGTGGCAATGTGGTTTTCCTCAAAGTGTGTACCAATCATGTTAACCATGCCAAGATACTTCTCA
TCGCCCTTTGGGCCCTTTTTCACTCCACCAAGCACCAGGGAGTTCCATAGAGGGTCAAACTTATTGCGCCTGTTGTACATTACTCTTGTCAGGTAGGCAT
GGATTTCCTTGGGGCCCAATGAGTTGCCATCATCCCACATATGATCATTCAAAGTTAATTCATCCAGATACCGCAAAATCTCCTGGAAATCACTGAACTC
CCCACTCCCTCCAATAAGGCTATGCTTTCCAACCTCCTTGATACGCTCCACACTCTTGTATCGCAAAGTTGACCCATAGGAGGCTCCAGTGTCACATGCC
ATGATCACACCATCCTTGTATTTCATTGCAATCACCGAATTACCAGTCACATAAGGATTCAGTGTCCTCTGCGTCCCGTCTCCTCCTCCGGCCGCCGCCG
CGGTCGCGTCCATCGGTGCGCGTGGGGGCTTGATGCGGCTTGGTTTCGCTCGTCGGCGGAAGACCTCGGCTCGGCTCCTC
page-top