Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24037  (registered. 2003)
Contig Information
Length 519 bp
Clones 23 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 4
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_VSCB Liquid cultured tissue 6
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit hypothetical protein OsJ_023685 [Oryza sativa (japonica cultivar-group)]
Score 347
Evalue 2.09426e-31
Total Hit Count 204
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24037
CTTTCCCTCGCCGCCGCCGCCTCCGTCGCCTCCTCCTCGGGTGCGCACAGTCGTCCACCATGCCGAAGCAGATCCACGAGATCAAGGACTTCCTGCTGAC
GGCGCGCCGGAAGGACGCGCGGTCGGTGCGGATCAAGAGGACCAAGGACGCCGTCAAGTTCAAGGTGCGCTGCTCCAGGTACCTCTACACGCTCTGCGTC
TTCGACGCCGACAAGGCCAACAAGCTCAAGCAGTCCCTCCCACCAGGTTTGAGCGTCCAGGAGGTTTAAGCATCAAGCCAGACAATGCCTTTTCTAGTAG
TGGGAATGTTCTATCCATCTTGCTTTAGTAACTGTTAGCAGGCTCTCCTTGTTTACCCCCATTAATAGAGTTTTGATGTTCCAAGACTGGAATGTAATGT
TGGGAGCTATGTGGTTGAACCTGTGAGGATATTTGTGTTATTTTCACTTGCTGGAGAAGGAGATCAATTATCTTATCCTAAATTGGTTTAGTATCTCACT
ATTTTCCTGAAAAAAAAAA
page-top