Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24034  (registered. 2003)
Contig Information
Length 833 bp
Clones 23 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 3
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_SHDr Shoot grown with dessication 2
Wh_VSCB Liquid cultured tissue 6
Homology (BLAST) Top Hit Os02g0670400 [Oryza sativa (japonica cultivar-group)] >gi|50251344|dbj|BAD28320.1| putative high mobility group protein [Oryza sativa Japonica Group] >gi|50252158|dbj|BAD28154.1| putative high mobility group protein [Oryza sativa Japonica Group] >gi|113537226|dbj|BAF09609.1| Os02g0670400 [Oryza sativa (japonica cultivar-group)]
Score 487
Evalue 3.60764e-47
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24034
TTTTTTTTTTAAGACGAAATTAACCAAGAGCCAATGGCTGGGCAGTCATCAGATTAGCGAATGAAAACAAGTTCTTACACAGGTGGTTAGCAAGAGAAAA
GCATTGGAACAGCTGGTAGCATTCTCTGCTTCCTCTCTGCTAATACACTACTAAACAACTTCTCAAACCATGAGTCCACAAGTCTAAAAGGGCCCCCTTA
ACACACAAACACAACATCTACTACCAAATCTCATCATCTAGCACTGAGGATAGCAGGATAGCAAACTAGTACACTAAGCGGGGACCCAACACCCAATTTG
CTACCTCATGATCTGATACACTATTTACTCGTCATCGTCCTCATTTTCCTCATCGCTACCCTCATCTTCGACCTCAGATTTGACCTCCTCATCGTTCTGA
GTCTTGGCCTTCTTGGAGCTCGCACTCTCCTTGTTATCAAAGGTGGCTTTGGTCTTCTCATAATCCTTCTTCTTCTGTTCAGCCTTTTCCACATAAGGTG
CTTTCTCCTCATCAGACATAGCTCTCCACTTCTCACCCGCCGCCTTGCTCACGTTGGCGACACTCTTGTTGTTGGGGTTCTCCGCGTTGTACTGCTGCCT
GAACTCAGACATGAAGACGAAAAAGGCGGAGGGCGGGCGCTTGGGCTTGCCAGCGGCAGCGGCGTCCTTCTTCCTCTTGCTGGCGCCGCCGGCGGCCTTG
AGCCTGCCCTCGCCCTTCTTGGAGGTGTCAGCCTTGCCCTTCATGGTGGAGGCCGCGGCGCGGGTACGGAGCTAGGGTTTTGCGGGGGGGCAGAACGGGG
GCGGGGCTTGGTTGGTTTGGAAGCGGCCTCGTG
page-top