Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24026  (registered. 2003)
Contig Information
Length 767 bp
Clones 23 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 8
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Homology (BLAST) Top Hit putative immunophilin [Hordeum vulgare subsp. vulgare]
Score 668
Evalue 3.18176e-68
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24026
ATCCTCCTCCTCTCTACCCGAACAAACCCCAGCTGCATCCATGGCGAAGCCGCGGCTTCTTCTCTGCCTGCTGGTCGCCGCCGCCGCGCTCCTGCTCGTC
GCCTCCGCGAAGAAGTCCGGCGACGTCTCGGCGCTCCAGATCGGCGTCAAGTACAAGCCAGAATCCTGCAGCATCTCGGCTCACAAAGGTGACAGAGTTA
AAGTTCACTACCGTGGAACACTTACCGATGGAACAGTTTTCGATTCTAGCTTTGAAAGGGGTGACCCGATTGAATTTGAATTGGGCACTGGTCAAGTGAT
CAAAGGATGGGATCAGGGAATTTTGGGCATGTGCATTGGTGAGAAGAGGAAGCTGAAGATCCCTTCAAAGCTCGGCTATGGGGATCAGGGATCACCACCT
ACCATTCCAGGCGGAGCAACTCTCATATTCGACACAGAGCTTGTCGCTGTCAATGGCGAGCCATCTAGCAAATCAGAGGAGGATGACGCTGATCTGTAGG
CAGCTCGGCGCAGCACGATCGCCCAGTTATCAAATCGAATAGGACTATGTATGGGAAACTTACTCTTGTAGGGCAGACACAATGAGGCAGGAACATTGTC
TTACCATGATCAAACAGAGGAGCCTAGTTCTCAAAATCGAATAGATCAAGTGACTTTTGTTACCCTATGTAATTCTCTGGAATAATTCTCCTATCTACCT
TGTTACTTTTGCTTTTGTTCTTGGAATGGTTATAAAGTACTACTCCCTTCATTTCTCAAAAAAAAAA
page-top