Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24021  (registered. 2003)
Contig Information
Length 945 bp
Clones 23 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 3
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit triticain alpha [Triticum aestivum]
Score 1010
Evalue 1.00523e-107
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24021
TTTTTTTTTTGATACACAAGAAATCTGCTTATCTTGTTTCTTGATGAATTCCATATAACAATAGCAGCCCCAAACTGCCTGGGAATGTGCTGAATTTACA
TATACATATGCAAAAGCAAATGTGGCGGTTCTGTGAACAACCGAACCCGATTTTAGGATTATGTACAGGAGCATCTACTATAAAGAAGATACTTGAGAGC
ACAGCTATTGCCATGCTGCGCCTTCTATCGTGGGTCACCAGGTGATCATTTGCAGAAGTTAACCACCATGGCCGTTGGCTGTAGGATTGTGGTGATGCAA
ATGTTTACGCGCTACTTTTCTTGCCGTCAGTTGCAATGACAGAGAAAGCACCGATAGGCTTGGCCAGGGTACGCCTCTGAGCCTTCACTGACAGTGGGCT
GTCCTTGGCCGCAAGGCAGGTTCCCTGCTGGGTGTTGCAGATGGGATAATTATGAGGGCAGCAGCTGTAGTGATCATCGCAGCAGGTAGCACCCTCGAGT
GGGCAACAGCCCCAGGCGAAGCACTCCTTGCCGTACTCGTAGATGCAGCAGCAGGTCGTGCTCGCGGGGCACTCGTTGTAGCTGTCACAGACGGAAGACG
GTGGGGCGGGAGATGGTGGAGTTGGGCCGGGGTTAGGGGGGTTCTCGCCCGTCTTCGTCGGGTAGGAAGGCTCAACGGCAATACCACATTTGCCACTGGA
TGCCTTGATGTTACGCTCCATCCGGATGTAACCATCCTCTCCCCAGACGGTACCCCAGGAGTTCCTGACGAGCCAGTAGTCCTTGCCGTTCTCTGTACCA
TAACCAACGGCGGCGACACCATGGTCAAGTGCTGTTCCACAGGTTCCAGTGAAGATACCCGATTTGTAGAGCTGGAATGCCCTGCCACCAGCCTCAATCG
CAACACTGATGGGCTGGTTTGCAACTGCCCCTCGTGCCGAATTCG
page-top