Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig24014  (registered. 2003)
Contig Information
Length 830 bp
Clones 23 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_DPA20 Seed DPA20 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 6
Wh_SHDr Shoot grown with dessication 2
Wh_VABA Shoot with ABA treatment 6
Homology (BLAST) Top Hit immature spike ubiquitin-conjugating enzyme 2 [Triticum aestivum]
Score 801
Evalue 1.39257e-83
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig24014
TTTTTTTTTTGAAGCAAACATGTTTTAATGAACATTTACCAAATAACACCAACACTGATGAAGGTTAACCCAACAAGCATAGGTGAATAGGCTGATAGGC
ATGCATGTCTGCCGATACTAGTGGCAATTGATGATAGGGCCGACGCCGAATGCAATTTACAATCCTTGAGGATCGGATTACACACAACCAGCAACAAATC
GAAGAAACAATGGCCCATAAATTTTTTTCTTGAAGCGACATTTCAGTTGTCCACGATGCAGGTCTTCAACCCATGGCGTACTTCTGCGTCCAGCTGCGGG
CTGTCGTCTCATACTTTGACCGGTCCGTCTTGTACATGTGGGCAATCTCAGGAACAAGGGGATCATCCGGGTTGGGATCGGTCAGCAGGGAACAGATAGA
GAGCAAGACCTTGGAGATCGTCAAAGCAGGGCTCCACTGCTCCTTAAGAATATCAAGGCATATGCTTCCATTGCTGTTGATATTAGGATGGAAGACCTTT
GTCTTAAAAGATACCTTTGGTGGCTTGAAGGGGTAATCTGGAGGGAAATGAATGTTCACTAAGAAAACACCGCCGGCATAGGGACTGTCAGGGGGTCCCA
TAATTGTTGCTTGCCAATGAAACATGTCCTCACCAGCAGGACCTGCGCTGCATGATGTGGGCGGGTCCTTCTGCAGGTCCTTCAGTTCCTTGAGGATGCG
CTTTGATGCCATGACAAGCAACCTTTTGCAGCGAGAGGTTGGGGACGGCGAGGACAGAGGGACGGAGGACGCCTGCCTTTGGTGGTCTTTTTTTCTCCCG
GGGTCCGCCCCTCGCTTTGTGGTGTCGTGC
page-top