Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23990  (registered. 2003)
Contig Information
Length 2264 bp
Clones 22 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 1
Wh_VSCB Liquid cultured tissue 3
Homology (BLAST) Top Hit hypothetical protein OsI_26489 [Oryza sativa Indica Group]
Score 785
Evalue 1.54829e-155
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23990
CTTATATTTGATGGCAGGCATCCATGCCCTTTTAATTCACCCGTAACTGATTTACAAGTGACCAACATCATCTAATTCATCTTACCAAAACCAAAACCAG
GACCAGGAACATAAATCAAGATGATAGGTAGACTAGCTGGTGCTCGACCACTGTCGTGTCGTCTGTCCAAGAGAAAAGGAAGCCACCGACCGAGCAAACA
GTCCATAACTTACTGTAAGTGATAATTAGTCTAATCGAGGACTAACAAGTCTTCGTCTGTGAATATCCGGTTGTACGACGAATCCATGTCGTGCACGACG
AGCTTCTCAGCGGTGATGCTGGCGCCGGTGGCATTGTTGAACAGGTAGACCCCCGCCGCCGCGTAAATGGCCTCCGTCGGGTAGGCCCTTGATGTCGCCG
TCATCCTCCCGCCCATCACGAAGCTCTGCACGATGGAGTGGTCCACGAGCACCCTAACAGACAAATCCTCGCTGTCGAGCACCGGTACCGTGCTACCCAC
CACCTCCTTCGCCACATCGGTAGCATGTGTCGACCGCAACTCATCGTGGCCTCGTGCCGAATTCGGCACGAGGGGAAGGCCTTCTGCGGTTGCCGGAGAA
CAGAGAATGTGCAGACTGCAAGTCAAAGGGTCCTCGATGGGCAAGTGTCAATCTTGGGATCTTCGTATGCATGCAGTGTTCTGGAATTCATAGAAGCCTT
GGGGTACACATATCAAAGGTAAGGTCTGCTACTCTGGATACATGGTTGCCAGAGCAAGTTGCATTTATTCAATCAATGGGAAATGAAAAGGCAAATGGCT
ATTGGGAAGCAGAGCTGCCCCCTAATTATGACAGGGTTGGGATAGAGAACTTCATCCGTGCAAAATACGAGGACAAGAGGTGGATACCGAGGAATGGAAC
ATCAAAACTGCCCTCTGGTGCTCGAGATGAGAAGAGCTCTGAATCTCAGGCCAGTCATGCTAACAGGGGTGGGCACGCTCAAAAACCTTCATTTGAGCAA
CACCGTGTTTCACCAGCTGCTACGAAAAGAACTGTTCCAGTGGCTTCTAGGATGCACACACAAGCATCACCTCAGCCAAAAGCAGAACTACCAGTTCCCA
AGGGTTGCTTCGCCTCCTCAGCCAGCAAAATCTCCTGCTAAAGTTGATGTGACACCCCCAAAAGTTCATCAGCCATCGGTTGCACCCCCTCCTAAAGTTG
ACTATGCCATTGACCTCTTTAACATGTTATCAATGGACGGAACAACTGAGAAAGAACCAGTGTCATCTTCCAACGACGATAATGCTTGGGATGGCTTCCA
GTCTGCAGAACCAGCACCTAACTCCGAGAAAAAGGATACTGCTAAGCCAGTAGAAAGTAAGGCCCAGTCTACAACGGGAATCGAAGACTTATTTAAAGAC
TCGCCAGCTGTGGCAGCGTCTTCAGCTCCAGTTGCTTCCAAATCAAACCCACAGACAGATATCATGAGTCTGTTTGAGAAGTCGAATATGGTATCACCAT
TTGCTATCCATCAGCAGCAGCTTGCTTTTATGACCCAGCAACAAGCTTTACTGATGGCTGCTCTTAAATCTGGAAATGCACCCCAAATGGTTCCGGGGAA
TGCACCCCAAATGGTTCCCGGGAATGCCAGTGTGCTAAATGCTAATGGTTCTAATGCCCCTAATGGAAGCTTGCCTTCCCATAGCTGGCCTAATCTAGGT
TATCAGAACCCTGCATCTATTCCAGCAGCAGCACCACAAAATGGTGTCGCCAAGGCTGGGAACAACAATCAGGACTTCTTTTCTGGGAACTTCGGTTTTG
GTTCGCCCGGCATGCCAGCAAATGGGTCCACAACCGCAGGTGCTAACAAGAGCGCATCCACCCCTACCTCTTCTACCCTGCCCTCTCAATCAGGCAAAGA
GTATGATTTTTCCTCATTAACGCAAGGAATGTTCTCGAAGCGATGAATGGCTTGAAATACTTGGAGATGGATGAGGCCTCCATTGGGCGCAGATTTAGGG
AGAACGTTGGGGGGCGCTTGTACACTGTTTTACCGAGGCAGCTTTGCCAGTTGTGGATACATAGTTACATCACCTTGTGGGTCAACAAGTGCGGATATGG
CAGAAAACTGCTCATGTTGTTTCCTACAGCTGAATAGTCGCATTGTTACAGTGATGCCAAAGAACTTCAAACAGAGGATTCCCTTGTGGGCCTGTTGAAC
TTTTCTCTTGTTCAGGGTGTAGTTGCAATACCACATATCGATTACTTTGTATGACGCCAATATT
page-top