Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23969  (registered. 2003)
Contig Information
Length 937 bp
Clones 22 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 7
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 1
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 1
Homology (BLAST) Top Hit Os06g0115500 [Oryza sativa (japonica cultivar-group)] >gi|7248415|dbj|BAA92738.1| putative 60S ribosomal protein L13E [Oryza sativa Japonica Group] >gi|24413953|dbj|BAC22205.1| putative 60S ribosomal protein L13E [Oryza sativa Japonica Group] >gi|113594653|dbj|BAF18527.1| Os06g0115500 [Oryza sativa (japonica cultivar-group)] >gi|125553806|gb|EAY99411.1| hypothetical protein OsI_21382 [Oryza sativa Indica Group] >gi|125595832|gb|EAZ35612.1| hypothetical protein OsJ_019095 [Oryza sativa (japonica cultivar-group)] >gi|149391053|gb|ABR25544.1| 60S ribosomal protein l13-2 [Oryza sativa (indica cultivar-group)] >gi|215678596|dbj|BAG92251.1| unnamed protein product [Oryza sativa Japonica Group]
Score 813
Evalue 6.96487e-85
Total Hit Count 302
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23969
TCTCAGGAGCAAGCTTAACATAGCATTAACCCCAAAACACAGGCAATCATACACAGAAACTGATCAGAGATACAAGGATAAAAATCCAAGGACACTCATA
GGATAAGATTTGATAGCAGATCATGCAAATAAGTATATCAGGTATCAAACAAGATGTCCGAGAAGGCCAAAACAGAAATTCAGAAACTAGCACTTGATAA
CAACAGAACCCACTAGCTGCCTTAAGCATCTCATCACTTCTTCTCCTCCTTCTCCGCCTCGGCAGCCTTCTTCTGCCTGGCTCCCAACTGGCGCTGGTTC
ATCCTCTCGACGCGGAGCTTGCCATAGGCCTTGAACTCCTTCATCTCCTCTGTGACCTTCACGACCTCGACTGAGCGCTTCTCGCCACGGGCAATGGGCA
TGTAGTCACCCTGGACCTGTGTGGCGTTGGCAAGCTCCTCCGGAGTAGAGTCACCAGCCTTGACCTTGCGAGCACGCCTTGGGAAGATAACAAGCTTGGC
CTTGTAGGTCTTGAGCCGCTGGATATTGGACTGCATACCCTCAAGCGACCTGTTCTTGCGGCGATGGTCCACAGAAATGCCAATGGTCGGAGCGAGCTTC
TTTGGGATGCCAGCGGACTTAAGCTCCTCAAGGGTAAATCCTCTGCCAGCCCTGGCCTTCATGTTGTACTTGCGGGTCTGGCATTGCACAATGGGGCGAA
GAGGTCCAGAGGTAGGGCGGGGGAAGATCTTCACAGCATTCTTCTGGCGAGCGATGCGACGCCTCTGCTTGCGGGCGGGCTGGTTGAACCACGTCTTGAC
ATAGTTCTGCCAGTGCTTCTTGAAGTGGCCGTTGGGGATGACGTTGTTGTGCTTCACCATCTCGCCCTCCTCTCCTCCTCCTTACCTGGAGACGACGGTG
CGGCGGCGGCGCGGGGGAGGGCTAGGGTTTTGCGGGG
page-top