Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23967  (registered. 2003)
Contig Information
Length 922 bp
Clones 22 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VHS Shoot with heat shock treatment 6
Wh_VWD Shoot grown with dessication 9
Homology (BLAST) Top Hit Os04g0459500 [Oryza sativa (japonica cultivar-group)] >gi|21740910|emb|CAD40906.1| OSJNBa0036B21.24 [Oryza sativa (japonica cultivar-group)] >gi|32479937|emb|CAE01532.1| OSJNBa0072F16.1 [Oryza sativa (japonica cultivar-group)] >gi|113564555|dbj|BAF14898.1| Os04g0459500 [Oryza sativa (japonica cultivar-group)] >gi|116310054|emb|CAH67076.1| OSIGBa0097P08.6 [Oryza sativa (indica cultivar-group)] >gi|116310439|emb|CAH67444.1| H0219H12.1 [Oryza sativa (indica cultivar-group)] >gi|125548571|gb|EAY94393.1| hypothetical protein OsI_16160 [Oryza sativa Indica Group] >gi|125590618|gb|EAZ30968.1| hypothetical protein OsJ_014451 [Oryza sativa (japonica cultivar-group)] >gi|215701204|dbj|BAG92628.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737392|dbj|BAG96321.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737398|dbj|BAG96327.1| unnamed protein product [Oryza sativa Japonica Group]
Score 447
Evalue 1.87547e-42
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23967
TGGCGTCGCCCATGCTCTCCACGGCCATGGCGCCACTCCAGGGGGGCATGCTGGAGTTCTCCGGGCTGAGGAGCTCGTCGTCGCTGCCGCTCCGGCGGAA
TGCCACCTCCGACGACTTCATGTCCGCGGTCTCCTTCAGGACATACGCGGTGAGCACCAGCGGCGGGTCGCGGAAGGCGCCGACGGAGGCCAAGCTCAAG
GTGGCGATCAACGGGTTCGGGCGCATCGGGCGCAACTTCCTGCGGTGCTGGCACGGGCGCGGCGACAGCTCGCCGCTGGAGGTCATCGCCATCAACGACA
CCGGAGGCGTGAAGCAGGCGTCCCACCCCCAACGTGTCCGTGGTCGACCTTGTGGTGCAGGTCTCCAAGAAGACCCTCGCCGAGGAGGTGAACCAGGCGT
TCCGCGACGCCGCCGCCAACGAGCTCAAGGGCATCCTCGACGTCTGCGACGAGCCGCTCGTGTCCGTCGACTTCAGGTGCTCCGACGTGTCCTCCACCAT
CGACGCGTCGCTCAGCATGGTCATGGGAGACGACATGGTCAAGGTCATCGCGTGGTACGACAACGAGTGGGGTTACTCCCAGAGGGTCGTCGACCTCGCC
GACATCGTCGCCAACCAATGGAAGTGAACGCCGGACGGCGGCATTGCCCTGTGAAGTGACTCCTCTCGAAATTTTCCCCAGCCATCGTCACGGATGATCG
ATTCTTTGTAATGAGAATTCAGAGTATCGAACTCCCAACAGCTTCTTTTTTTTCCTTTCTTTTCTTGTTCTTCTTTTTTCTTTCTCTGATTTTTCAGTGT
CCAGACACGGATTATAATAGACTTCCTGCAAAGGAAGTCTCAACGCTGTGCATCTGTAATATATACTATCGTTTGCCAGGTTCTGATGTAGAATTCAACT
CGTTCTTGGATTAAAAAAAAAA
page-top