Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23949  (registered. 2003)
Contig Information
Length 805 bp
Clones 22 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 14
Wh_VABA Shoot with ABA treatment 6
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit hypothetical protein [Dictyostelium discoideum AX4] >gi|60469697|gb|EAL67685.1| hypothetical protein DDBDRAFT_0205801 [Dictyostelium discoideum AX4]
Score 122
Evalue 7.13449e-05
Total Hit Count 462
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23949
TACTACAAAGCAAGTGAGCTGAGTGAGCTGTGAGCAGCTAGCTAGTGATCGGCGACGATGAGGGCATCCGCCTTCTCGCTGTGCTTGCTGTTGGCCCTCG
TCGCGGCAAATGTTGCTAGCCTCGCCGTCGCTGGGAGGGCGCCGGAGCTGAAACATGAGCCCAGCCTAGAGCCGAAGCCTACGCCACAGCCTGACCCCAA
ACCAGACCCGCAGACCGACCCTAAACTCGCGCCGAAACCTGACCCGACACCCAAGCCCGACCCTAAACTCGCGCCAAAACCTGACCCAAAACCAGACCCA
AAACCGGTGCCGAAACCTGACCCAGCACCCAAGCCCGACCCCAAACCGGCGCCGAAACCTGACCCAGCACCCAAACCCGACCCCAAACCAGACCCGCAGC
CCGACCCTAGACCGGCGCCAAAGCCTGACCCCAAGCCCACGCCCGACCCAAAGCCTGCCCCGGGCCCCAGCCCGAAGCCGGACCCCAAACCCCAGACGCC
GGAACAATCGTCCTCGCAGCCGAAGCAGCCGCCACGTTCGCCGTCAGGCTACTTCAACTGACGGGAGGGAGGCTCGTCAGCAGCCGCTTGGTAATGGAGA
ATTAGCCTGCCTGCATTTGCATGGGTGTTGGTGCTTAAGTTGTCTCCGGTAATGGTTAGTAATGTATTGCATGTGTTCCCTCCGTCTCTGTACGTGTTGT
CTCCAGTTTGTTCGTGTGAGCCATCTTTGCGTCAGTGTGTCTCCCGTGTGATGTACCATGAATAAACAGAGGAACATGTATCCCACTTGATTTTCAAAAA
AAAAA
page-top