Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23946  (registered. 2003)
Contig Information
Length 905 bp
Clones 22 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 5
Wh_PCDAM Anther at meiosis 3
Wh_RDr Root of dessiccated seed 4
Wh_SHDr Shoot grown with dessication 3
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195618520|gb|ACG31090.1| vacuolar ATP synthase 21 kDa proteolipid subunit [Zea mays] >gi|195629280|gb|ACG36281.1| vacuolar ATP synthase 21 kDa proteolipid subunit [Zea mays] >gi|195653101|gb|ACG46018.1| vacuolar ATP synthase 21 kDa proteolipid subunit [Zea mays]
Score 753
Evalue 5.95736e-78
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23946
TTCAACAGGCAGTCCACGTTCTGCAAAAGCAATAGCACCTACAAGATGATACCTGGCAGGCATATGGAGTCTTTACAGTAGGAACAGTATCTCTACGATC
AGATGCATCAAGCACCAAAATACGTGATTTACCAAAAACGTGCAAAAGAAAAAAGAATAGATAAGAAACAGTTGAACACATGTTGACATTCCAAAGGGCT
TCACCCAAAATAATTTACAGAGATTCCCAGATGGATGGAATTAGACTTTTGTTGGCCATGTTGCTTGAGCTGACATGATTATGCCCACGATCACTCCAAA
GAGGCCCAAAGCACTGCCAAAGATCTCAATCACCAGGATCTTTACAAAGAGTGTTGAATTCTGGGCATCAGACAGTGCACAGCTGCTTCCGATTATTCCC
ACGCATACCCCGCAAACAAGATTAGCAAAGCCGACAATAAGACCTGAGGCAAAGATTGCATAACCAGCTCGCATAGACTCTGGATCATGCATTCGGGATG
TTGGCACACTTTCAAGCTTTGTTTGGAGGATGATCGCCACGATTACACCATAAATTGCAACGGCCTCACAGAAGATGACACTGATGAGGTTCTTGGAGGT
GATCCTGGGCGCCTTGATGGCGGCCCCGATGAGGCTGCTCCCCGTGATGAAGATCCCCCATGCTGCGCCGAGGACAGAGACACCGATGGAGACGGCGATG
CCGATGGCGGAGAAGGTGTAGGGCGAGATATGCACGAGCGCGCGCGCCCACGACGACGAGTAGTCCGACGACATCCTCCCACCACGATCTTCACCGGTGC
GCGCTCGTTGCTGGATCGGGGATCTTTTTTTTTTCTCGCGATGGTTTGGATCGGTGACTGGGAAAGGAGAGAGAGTAGAGGCGCGATGGAGGAGAAGATG
TGTGC
page-top