Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23940  (registered. 2003)
Contig Information
Length 1717 bp
Clones 22 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_SHDr Shoot grown with dessication 9
Homology (BLAST) Top Hit Os01g0513400 [Oryza sativa (japonica cultivar-group)] >gi|56201637|dbj|BAD73084.1| unknown protein [Oryza sativa Japonica Group] >gi|113532713|dbj|BAF05096.1| Os01g0513400 [Oryza sativa (japonica cultivar-group)] >gi|215697526|dbj|BAG91520.1| unnamed protein product [Oryza sativa Japonica Group]
Score 703
Evalue 3.14247e-74
Total Hit Count 91
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23940
TTTTTTTTTTGAACACTACAAGGGCCCAGAAGGACCCAGCACTTCATTGATTATGACGAAGAGACATTATAGCTTACAACAAGGACACTAAAGAAGCTGA
AAATAAAAACAAATCCCTGCATCTTATAGAAAGGACCCCAAACATAAAACTGAAAACGCGATCGGGTCCACGCTGTGCCGCAGTGGATACAATCATCGCC
GACGCCTGGGACAGACCACTTGGTCCGGCGAGACCTCTGTAGCAAGCCACAGACTCCAATTTGGCACAGCACTGCCTTCCTTCTGGCATCGTGGCTGGGA
GGAACAAGTATGGCCGCCCTTCGACCAGAGGAATCGATGGATTGTTGGAGGAGACCGGTGTCGTAGCTCCTTCAGATCCACCATCGAATAAGCTCAGGAT
CCCCATCACCAGCTTCCAACGAGATAGCGGAAGCCCTTTCCCAGATGCGGGGATAACACCACCTACGCCGGAAGCTCGGATCCGGCGAGGCCCAGCACCA
CGAGGAGGCCGAGGCGAGATCTCTCCACCTTTCTGCTACCATCACCACGACGGCAAGAAACAGAGGAAGGAACCACCGTGGCTCCTAGATGCTGGACAGA
CTGAGCTTATTGGGAGGGATACTGCCAGATCCAATGTCCACCAGTCCCCTCCACCATGGAGGCGAGGTAGGAGACAACGACGACCACCACCAGACTCTGC
TCACAAGGTCTAGCAGCAGGTATCCCGACTGGCATGAGGCCACACCATGGCATAACGCCAAGTCTAACTAAGTCTACTGCTACTCTAATATACATATGGA
AGAACCAGGCACCTCTCCTCAACCATCGCCAGCCAGCATCGCCGACGAACGAGGCATCAGATCGCCCCGGCCGGGGATAAGCGACTCTCAAAAGGGGGCG
GTGGAAGAGATGAGAAGGGGAAACAGCCGCGACCTCTTTTTCCAGCAGGTCAGTGTTGAGGGGGCATCGGTTGGATGTATGCATCCAAGCTTCAAATCTT
GTGGTAACATGCATCAGATTTGGAAGGAGTCAACCAGTCAGTCACTCAGAACTTAATCATGTTCACAAGACACTCTTCGGACATTCTTTCATGAGCTCTG
CAGAAAGCACAGATTTGGTGTCACTACCTGTTGTATGCACCATGGGAGACAAAGAACTGATAATCTGGATGGCCGGCACGGCTGTCTCTCAGCCAATCGG
CAGCAGCTTGCCTTAAGCAGCTAGCCAGTTTCCAATCACCATCAGTTGAGGACCAGACTGAGTTGCTAAACTTGTAGGAAGCCAAACCAAAAACTGGGAG
TGGTATGTTTGGTGTGCTATCAGGAGCCCACAGATTATCTCCTTGCGGGCAATTTGAAAGCTGATGGAAAGTGAGAAAGCAGGCATCTAAATCTTTTAAT
GTTGGTCCAGTAGGGATACGATAAATTGGGTACCAAGCGATGCTCATCCAACTCCGTGCTGATAAATCACAACTCCTAAGGGTCCTCAATCCTGGAAATC
TGGCTGAAAGGCTAGAAATCTTATCAGTCAAAGGTTCACGGCAAAATGGAGAATCAAACTCGAGGTACTGAAAGAGCAAGCGGCCATGAGTAACTCCAGA
ATTCACCAACATCCCTTGAGAAGCCTTCCTGAGCAAAGTGTTTGACCCTTACATGTTCATAATCACTGCTACCATCACTGCTGGAATCATGGAAATCTTC
ATCACTGTCGTCCATCA
page-top