Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23931  (registered. 2003)
Contig Information
Length 1295 bp
Clones 22 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 5
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 4
Wh_RDr Root of dessiccated seed 1
Wh_VSCB Liquid cultured tissue 4
Homology (BLAST) Top Hit histone deacetylase HDAC2 [Triticum aestivum]
Score 1054
Evalue 1.28209e-112
Total Hit Count 287
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23931
AAACCACACAGGATTCATTCATTCAAAACCATGATGACCATAGCATTCCACCAACCAATTCCAATTCCGAATCACAGCGGCTTTTTTGTTCGATTCAACA
ACAAACGCATCAACACTAACAGCTCAACGGTTTCTCCCTTCCCTTCCCTCGGGATCAGGCTAGGTAGGTACGACAACATAATAAGATATAGCAGATAGCC
TAACACAGCAGCATAACGATAATAATCTCAATAGGGCAGACAGATCAAAATAATAGCAACTGGAGCCAGCCAGCCAGCCAACACCTTCCTCTCCTCTTCA
CTTGGCCTCGTGCTTTGCCTTGGAGTGCGAAGCTAGAGCGCCCTCGCTGTTGAATGTCTTGCTGCACGACTTGCACGCGACCGACCCTCCAGACTTGGGC
GACTTGTCGCTGGTAGCCGGGGTCTTGCCTGCCTTCTTGGCCGGGTGAGGAGTCGCCACATGGACAGCTCCCTTCTTGTCGCCTGTCTTCTGGCCTGACG
GTGTTGCAATCTTGGCCTTCTTGTCAGTAACAGGGGTCTTCAACACGCTTCCAGCCGCCCTCTTCTTCCCAGTCTCTTGCTTCTTGGGTGTTTCTTCTTC
CTCCTCATCAGAGCTATCCTCACTATCATCAGAGGAATCATCACCGCCCTCACTATCATCAGAATCATCCTCCATGGGAATCAATGCTCCATCATCACCA
GAGTCATCTTGGCTGTCATCCTCATCACTGTCATCATCATCATCGCTGTCATCATCCTTGTTAGATTTTCCCCCATCCTTAGCAGCAGGCTTGGACTTTG
AAGGGGCAGCAGTGTCAATCTTAACCTGCTTCTTCTGCTCCTTGGCTTCAGGTTTGCCATTCTCCTTGGTGAGTGCTGGAATGATGGTGTCTTGCTCCTC
CTCAGACTCTTCCTCGGAATCAAAATCCATCTCATCTCCGTCGGCAGGCTGGAAAACCTTGTAGCCAGAGAAGAAGACGCTGGACGTCTTGGAATTGTGT
GAGAGCTCAAACTCCTTCTCAAAGACGAGGTCGAACTGGATCTGAGGGAACTTGTCAGTAGAGAGGGTCCCGATGGCTAGCTTCTGGTCGCCAATCTTGA
CGAACATGGTAGCCTTGTCATCCTTCTTGACTTCACCAAGGGCACCCTGGGAGAGATGGAGGAAGTGGTCATCATCAGGTGAAACCTTGAGGGACTGGTT
AGGCTTAACCTCAAGGCCCCAGAACTCCATGTCAACCGGCGGCGGCGGAGGGTGGCGGCGGTCTAGGGTTTAAGCCGACGGAGGGAGGGGATGGG
page-top