Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7735  (registered. 2012)
Contig Information
Length 825 bp
Clones alternative view 10 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 3
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_VHS Shoot with heat shock treatment 3
Wh_VSCB Liquid cultured tissue 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115467746|ref|NP_001057472.1|| Os06g0308000 [Oryza sativa (japonica cultivar-group)]
Score 332
Evalue 4.00E-89
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7735
TTTTTTTTTTACGCTGTAAAGAGAAAACAATACCTCACATAATATAGTACTCTTGGAGTATGTTTATGATATTTGAGCTCGGGATTAGAGTAACACTCTC
GGTACGTATAGAGCAAACTTGACATCTACATGTAAACGAGACTTCTCTCTTGTGCTATGAACAAAGCAAACTCTTCTGTCTGCAAAACCAAGGTAGGCCA
GAGAGAGTTTGCACGCCTGCCATCCTTGAAAACTGACAGAGCATCTAGCGTCGCGCTCATTTTTTTATGTACTCGATCGTGCAGTTCTCCTTGAGCCACT
CCAGCACCTTGGCAGCCTCCAGAACATCCTGAACCTGCTGCTTGATGTTCCCCTCATCGTAGTCTTGATTATAGCGTTTGAACTCTTCTATAGAGTTCTC
GACTTCCTTGACGAGCTGGTCTGTCGAGTACTGCAAATTTTCGGCCTTGAATATTTCACCAACAACCAGCATTTGCTTAATGATCCTAGTAATGTTCTCC
CTCTCACCTTTTAGGTACTCCTGGACCGACTTCTCGCTTGAAAGGGATGCTAGCTGGTCTTTGTCTAGCTTCCTTTCGGCCTGAAGTTGGAGAAGTTTCG
CTCCATACAACTGTTGGCCTTGTTCTTGAAACAAGGAACGTGGAACATCAACGTCTACCAACTTTCCCAGTTGGTCGAGGATTGCATTATCTGTTGCTTG
TTCTATAGCCGTCTTCTCCACTTCTTTGCATCTTTCCAAAATTCGTTCTTTGACCTCATCGATGGTATTGCATCCTGGAAGGAGCTTTGCGGCAAGCAAA
TCATCCAATTCTGGCAACTCTCTGA
page-top