Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23916  (registered. 2003)
Contig Information
Length 872 bp
Clones 21 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 7
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 9
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195619630|gb|ACG31645.1| polyubiquitin 2 [Zea mays] >gi|195620202|gb|ACG31931.1| polyubiquitin 2 [Zea mays] >gi|195620238|gb|ACG31949.1| polyubiquitin 2 [Zea mays] >gi|195620732|gb|ACG32196.1| polyubiquitin 2 [Zea mays] >gi|195620942|gb|ACG32301.1| polyubiquitin 2 [Zea mays] >gi|195628320|gb|ACG35990.1| polyubiquitin 2 [Zea mays]
Score 677
Evalue 3.61548e-69
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23916
TTTTCCGATCATCTTTCTGCATTTAGCCCTACATCAAACTTGAATTCAGGAAAGAGTGGCGAAACACAATCAAAATTCAGGTGATATATGGATCTTACTA
CGCAGCAGAGCTAATAACAGAGGCGGATAAAGTTGCGACTAGTTTTGTCAAATCATATAGGCAGATAACATGGAAGACAGCCCCTCCCACTAAGCAAAGC
TAGTTTGTTATTATCTCTTTGCAACACCAACACAGGTTCCATGCCACCAATGGTCACTTCTCTCAGGAGGCAAGTGTTTCCATTACAGCTTAACTAGTAA
CCACCCCTCAGAGCAAGGACAAGATGGAGGACCGAGCCACCTTCGATGTTGTAGTCCTTGGCAGTCTTGTCATCTGCAAGCTGCTTACCAGCGTAAATCA
GCCTTTGCTGCACAGGAGGAATGCCTTCTTTCTCCTCAACGCGCTCCTTGATCCTGTCAATCGTGTCGGTGGGCTCAATGTCGATTTCGATCTCCTTCCC
AGTGAGAGTCTTGACCTTGATCATCGTGCCGCCCCTGAGCCTGAGGACCAAGTGAAGAGTCGACTCCTTCTGAATGTTGTAGTCAGCAAGCGTGCGTCCA
TCCTCCAACTGCTTGCCAGCAAATATCAAACGCTGCTGGTCCGGAGGAATCCCTTCCTTGTCCTGGATTTTGGCCTTGACGTTGTCGACGGTGTCGCTGC
TCTCGACCTCGAGGGTGATGGTCTTCCCCGTGAGGGTCTTGACGAAGATCTGCATCTTCCTGCTGCTCGTGCGTGCGGTGCGGGAGGGAGTCAAGCTGCT
GGTCGCGTGAGGACGACGGAGCGGGGGCGGAAGCGGACGAAAACGAAACGAAAATCCTTTCTTTTCTCCTCG
page-top