Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23913  (registered. 2003)
Contig Information
Length 746 bp
Clones 21 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 1
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 3
Wh_VABA Shoot with ABA treatment 3
Wh_VHS Shoot with heat shock treatment 3
Wh_VSCB Liquid cultured tissue 5
Homology (BLAST) Top Hit ubiquinol-cytochrome c reductase complex 14 kDa protein [Zea mays]
Score 449
Evalue 7.44255e-43
Total Hit Count 126
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23913
TAGCACCATAGCTCTGTAGAAATGGGAAGCGTAAACCCAGAAGCAAACAACAAAACAGTTGCTCAACGGAAAAGTCCCAAGAGCAGAGAGTTGTTCAGAC
TTCTACAGCAACAATTCCGTCAACCAAAATAAACTTTTATATCAGCAACAGCAACAGAAATTCTGTCGCAATTAATTTGGGAATGGGCACGAGAAACTGC
TACAGGCAATGGACATGAAACCGGAAGTAGGAATAGTGTCATAATCTGCATTTTATTTCATGCATTATGATGCTACGAGGAGCAAAAACTGTGGCGCATA
TCATGAAAAGAAGTCTTCAAGGAAGGGTTCTCTCGTAGAGGGGAAGGGCTCCCAGTGCTTTACGCTCTGCTGCCTCCTTTTTCACCAGAGCCAGCATGTC
GCTCAAATAGCTTTTGAATGGTGTCTGCAGTGCCCGGACGTCGTCGGGGAGGTACTGGTGCTTCATGGAGAGGTCCATGGCGCGCTTGAGGCGCTGGTGG
CGGGCGTCGACCACCTCCCGGGGCAGCCTGCCGAGCGCCTCCTTGATGTCCAGATCGAAGTAGGGGTCGTACAGATCGTCGTACCTCAGGCCGAAGTTCT
TGAGGCGGTTGGAGATGGTGAGCATGTGGATGCGGGCCAGCGGGTTGCGGCGCGGGTTCACGAACCACGACGAGAACGCGGACAGCATCGACGTCATCCT
GGGCGGCGGCGGCGGCGGCGGCGGCGATCCCCTTTCGTCTCCTCTC
page-top