Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23908  (registered. 2003)
Contig Information
Length 2651 bp
Clones 21 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 6
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 5
Wh_SHDr Shoot grown with dessication 5
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit hypothetical protein OsI_02907 [Oryza sativa Indica Group]
Score 1212
Evalue 2.50507e-149
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23908
CACCCCGCTCACTCCCGTCCTTCCTTCCCTCCTACAAATCTGGTCTGCTGGCCGCTGTTCGCCGCGGCCGCCGGGTCTCTCGCGCTCGCGCTACTACCTC
AAAACCCTAGCCACCCTCGCGACCCAGTCGATTGGATCGCCCGCTTCCTCCTCGTCCTCCACCCAGACCCAGGGACCGCTGATTTCACTCCTCTGTGTTT
TCAACTCACTTGGGCTCTGCGAGAGTGCTGCTATACTGGCAGGATCATCACCTTCTGTTTGGCCTGAACTGTGGAAGTTTCTAAGTAGAAACTGAGGGTC
AGTTCAAAACTTCATCCCACTCACCCCATACATACTGGCGAGAAATGGACCGTGATGATGTATCTGGCTTTGTTAGCGGGGGTTGCAAGCTGTTCTGAGT
TTTCTAACCTAGTAGAAGTTCATAAATAAAGTTATGATACCAGGAAGTCAGTCAACTGGTGGTTCTTTTCATTTACTAATTGGTTGATGTTTCCGAATTG
GAATGGACAAAACTTCTCATGGCCTTGGATTTGGTGATAGCATCAACTCGTTAAACACTTCTCAGTACCAGAGTTCAGTCCAACATACTGCTCAGCATAG
AGACACTACACTTGATTCCACATCATACTCCAGCTTTTCATTCACTAACACAAAAGCCCTGAAAAGGAAGTGGGGTACTATGGCGGGAGCAGAAGGTACT
GGGGATGCATTACTCACTCTGGGTTTAGGCCGTTCACCAAGTTCATCTGACGATAGCAAAGTAAGCTCTGCCACAGCTTGTGCAATGTCTCCATGCTCGC
TAAAGGAGGCTGATGAGGAGTCATCTGTTGATCTTAGCTTGAATTTTGAGCTTTCCCTTGGGCAATGATGTTGCACACTTCCAAAGGAAATCCTCTGCTG
GTTTGGTGGCCAAATCTCCTAAACTGGATCTTCAGTTGAGTTTATCCACTGGCTCACCTGAATCTGCTGTCACTTGTACAAATATGGTGTCACCAAATAT
TCATGATGGCTTGGACATACCAGTGACCTATTCATTACCAGCCATTATAGGGAATGGGTCAGCACCGTCTAGTTGGGGTTTTGAGCACTCTGTGATTTCA
TCATCATATGCGTCTGAAGCAACATATGCCTTCCCATTTTCGAAGATACCCAGACAAGAGAATGGTACTTTGTCTTCGCCAGTCATATCGTCAACTCTGC
CAGCAAGTGTGAAGAGCTCGGTTGCCTGTACTTCGGTGGTAACTAACCCTCAGCAGCGCAATCTTAACACTAAAACCTGCCAGTTCCCTGGATGTGGGAA
AGGGGCAAGAGGTGCATCAGGGCATTGCATAGCCCATGGTGGTGGTAGGCGATGCCAGAAACCTGGTTGCCAGAAGGGTGCTGAAGGAAGGACCATATAT
TGCAAGGCCCATGGCGGAGGGAGGAGATGCGAGTTTCTTGGATGTACAAAGAGCGCTGAAGGGCGCACCGACCACTGCATTGCCCATGGTGGTGGCCGCC
GGTGCAGTAATGATGGCTGCTCCCGTGCTGCCCGAGGAAGATCTGGCTTATGCATCAGGCATGGAGGTGGAAAAAGGTGTCAGCAAGACAAGTGCACCAA
GAGCGCAGAAGGTCATTCTGGCCTCTGCATCTCTCATGGGGGTGGGAGGCGTTGCCAATTTCCAGAATGTGCAAAGGGTGCACAGGGCAAGCACAAAGTT
CTGCAAGGCGCACGGTGGAGGGCAAGCCGCTGCCACTTTCTTGGGCTGTACCAAAGGAGCTGAAGGCAGCACCCCTTACTGCAAGGGCCACGGAGGAGGC
AAGCGCTGCTTGTTTGAGGGTGGTGGAGTGTGCCCCAAGAGCGTGCATGGCGGGACGCAGTACTGTGTTGCGCACGGTGGTGGGAAGAGGTGCGCTATTT
CTGATTGCACCAAGAGTGCTAGAGGGCGGACGGAGTACTGTGTGCGCCATGGTGGTGGCAAGAGATGCAGGTTCGACGGCTGTGTGAAGAGTGCGCAGGG
GAGCACTGATTTCTGCAAGGCGCACGGGGGAGGCAAGCGCTGCTCATGGGGCCTGCCGGACTCGAGCTTCGGTATTGGCACAGAGCAGTGTGATAAATTT
GCTCGCAGCAAGACTGGCCTCTGTTCAGCTCACACCGCTCTAGTCCAGGACCACTGTGTTCATGGTGGTGGTACATTAGGCCCTGTGATCCACCACTTCG
CCACAGATGTTAAACCCGACGAGATGGAAGTTGCTGCAGCAGTGAAGGTTGATCCTGTTTCGATGCAGTCGGAGCCTCCATTGCCGGAGGGCAGGGTGCA
TGGCGGCGGGCTGCTGGCGCTGCTTTCTCGCGGCGGAAACCACACAGGCCCTGTTGGTAACTCGGAGAACGGCGCTTCTGTCATGATGGCGTGGATGTGA
GTGGGCGGACATTCTCATCAAGAATTGGTTGCTTCAAGTTTTGATCTGTTTCCAGAGCTAATGCTGTGATCCACATTTCACCAATTGTTGTCCTAGTCGT
TTGGAAGTGATAGGGGACATATATCCTCCGTGTAGAATAAATAAGGGAGAGCGTTGTGGGATTCTCTGTTATTGTAATTAATTAATTATTAATGTCGTCA
AACTGCCCTTGCTTTGTGTTTATTACAATATATATGTAGTCTGATACTGCT
page-top