Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7732  (registered. 2012)
Contig Information
Length 877 bp
Clones alternative view 26 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 1
Wh_r Root 1
Wh_SHC Shoot grown with cold treatment 1
Wh_VHS Shoot with heat shock treatment 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 2
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XE Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218196507|gb|EEC78934.1|| hypothetical protein OsI_19367 [Oryza sativa Indica Group]
Score 360
Evalue 1.00E-97
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7732
TTTTTTTTTTGCAAATCACCATGTCTGGACGGATGGGCAAGACAATAGACAACCGCATGATGCTGCGTTCCACAATATAAAGCATTTATGAACTTCATCA
ACTCTTCTGTAAGAAGTATGTTGGTACCATCAGGTATCAACTGGCAAAAAATATTTGAAAATAACTGCTCCTTGGAGAAATGCTTTTGCAGCAGAGGAAG
AAAACAAAAGAGATTGTACCCAAGGTATGATGGGAGACAACCCCAGTAGCAAAAATATACAACGGAAGTCATTATTTCGATCGCTTCTGCTTAAAGCCTC
AACGTTGCAATAAAAAGAAGAAACAATGGTCATCAGTTGACGACGTCCAGGACCAGCTTGCGGGACTTGAGGACGGACCACCTCATGCGACGGTAGTATG
CGGCTTGGAGAAGAGCAAGTGACAGTAGGAAGATCCATTTGACACCCATCAGTTTCCTCTCTTCCATTTCAGGCTCAGCAGCCCACGACAAGAATGACAC
AACATCCTTGCCCATCTGAGCTTCAGTTGCAGGAGTACCATCTTCATACTCAATAGCTCCATCCATAAGCATCTTAGGCATGGCTATGGCACCACCAGGG
AAGTAGGGATTGTAATGCAGACCCTCACGAATCTGAACACCAGCAGGTGGGTCATGGTAACCAGTAAGAAGAGCAAACACGTAGTTCTGGCCATCGTGCC
TTGCCTTCGTGATAAGGCTGAGATCTGGGGGATATGCCCCACCATTTGCAAATCGGGCTGCTTGTTCATTTGGATAAGGCTGCGGGAAGCGATCACTCAG
CTTGCCAGGACGTGTGAACATTTCACCCTCATCATTANNACCATCAACCACTTCAATTTCAGCAGCCATTGCCTTAG
page-top