Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23880  (registered. 2003)
Contig Information
Length 1184 bp
Clones 21 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_KMV Shoot grown with continuous light after cold treatment 6
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 1
Wh_SHDr Shoot grown with dessication 4
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 2
Homology (BLAST) Top Hit hypersensitive response protein [Triticum aestivum]
Score 1420
Evalue 4.10165e-155
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23880
AGTATAATAACCATATAACACACGTCAATTCACAAATAGTGGTGAACGCAGTGATAGCACAACTTATATTTTTTACAGAAACGAGTGGCACAATCCAAGC
AAGTACTGATATTAACATCCATCTAGGCACAACCTCACCTCACCTCACACATAGTATAAGAATAAGCTGTATGTACTTAAAAGTATGCGTATAAAAGTGG
CATCCATTTTCCAACACTCCTCAAACCATCCTGCCCTGGAGCTGACCATCTCGTATCTGCGAAGCGATGTCTTTGACAGCGCCAGGCCCGTGAGGGATGA
ACACTGCTGAAGACTTGGAAGAGGCCCCAATGTCCTTCATGGTATCGAAGTACTGCGTCACCAAAACCATATCCATGACATCCTTCGAAGAGGTCCCAGG
CACATTCTCAGAGAAGGCGAGAACACTGTCTCTCAGCCCGTCCACTATGGCCTGGCGCTGCCTTGCAATACCCACACCAGCCAAGTACTTCGATTCTGCC
TCACCTTCAGCCCTCTTGATCTGGAGTATCTTCTCCGCTTCCGCTTTCTCAGTGGCTGCCAACCTCATCCTAGCAGCTGCATTGATCTCATTCATGGCTC
TCTTCACATGTTCATCTGGCTCAATATCAACAATCAGAGTTTGCACAATCTCGTACCCGTAGGCAGACATTGCCTTTTCAAGTTCATCCTCCACAGCCCT
TGCTATTTCATTCTTCTGCTCAAATACATCATCCAAGTTCATCTTTGGAACGCTAGCCCTGATCACGTCAAAGACATAGGACTGGATTTGCTCCCTGGTG
TTGCTAAGCCTGTAAAAGGCATCAGATGCCTTGTCAGCAAGAGCACGGTACTGCACAGATGCCACAACGTTGACAAAGACATTGTCCTTGGTCTTGGTTT
CGCATCGGACGTCAAGCTGCTGCACACGCAGAGAAAGATACCCAGCAATCTGCTGCCCTAGGCACCATGGCAAGCAGTGGCATCCAGGTTGCAGGATCGC
ATCAAACTTCCCAAAAGTCTCCTTGATGGCTACAGTTGATTGATCAATCTGTATCAAACCAAGTACCCCACCCATGGTTTATCTTGCGGCAAGGGTAGCT
GGGCTGCTGCGCCGCGTGCTGACGAGCTTGGCTGGTTGGATTGGTTCGTCCCCCCGTCCGGCCGGCCGTCTGCTCTGCTCTCCG
page-top