Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23872  (registered. 2003)
Contig Information
Length 1222 bp
Clones 21 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_OKCS Seed DPA5 3
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 2
Wh_VWD Shoot grown with dessication 4
Homology (BLAST) Top Hit iron-sulfur protein1 [Zea mays] >gi|1717957|sp|P49727|UCRI_MAIZE RecName: Full=Cytochrome b-c1 complex subunit Rieske, mitochondrial; AltName: Full=Ubiquinol-cytochrome c reductase iron-sulfur subunit; AltName: Full=Rieske iron-sulfur protein; Short=RISP; AltName: Full=Complex III subunit 5; Flags: Precursor >gi|168607|gb|AAA33507.1| Rieske Fe-S protein
Score 1154
Evalue 3.00082e-124
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23872
TTTTTTTTTTGAAGAATGTTTGCTTATTTATCAAATATATAGGGAGCAAGAACCAGAAGAGGTGTACAATATCCTTCCAATAGGGTCTCAGAAAATCAGT
ACAAAACTTACAATCCAGTAGCAACATAGGAGAAACAATTATTTCGCACTGCAAATGAACTTCGGTAGGTAACAGTGGATCACCGTTGCGATAGTCCTGA
AACAAAAACTCCTAGCCACATTGAAAACAAAATAACAGCGCAACAGGAATTCACTCCTGTGGAGAATATATGTTGGTAGGTACTGGTTTTAGGCTCTTAG
CCTATGAGCATCTTGTTATCTTCCAAGAAACTGTAGGTGGGCACCTCAAGGTTGTACGGGGCAGGGCCCTTGCGGATTCTGCCAGAGATGTCATAGTGGG
AGCCATGGCACGGGCAGAACCAGCCACCAAAGTCTCCAGAGTTGGGAAGGGGAATGCAACCAAGATGAGTGCAGACACCAATAACCACCAGCCACTCTGG
GTTCTTCACACGCTCAGCGTCTTGCTCTGGGTGGCGCAGGGATGCAACATCCACGCTGTTGGCCAGCTTGATGTCATCGTCTGTCCGTCGCCTGATGAAG
ACTGGCTTTCCACGCCACTTGACAGTCACTGTGCTGCCGGGTTCAATGCTGGATAGATCAACCTCAAGGGAAGCAAGTGCAAGAACATCCTTACTTGCTG
ACATGCTCAAGACAAACTTCAAGACAAGGAGACGCAGCAGTGATGCATATACGAATCTCCCACCACTCAGAACAAAGTAGGCAAAGGCACGCTTGCTGGG
ATCTCCAGGAGGATATCTTTCATGGTTGTACTGGTCATAAAGGATTTTTGAGTTGGGGTTCTTCAGTGCAGCAACAGTGGCTGGGAGTTCAGCCAACCCA
GCATCTTGGTTCCGTGGAACAAGTGTTTCAGCCGAAGAAAAGCCTCTCGCGGCGGTGAAGAAGGGGGACTCGATGGCGAACCGCCGCTGGTAGGCCGAAC
CGTCGTCGTCGTCTCTCCCAGGGCCGCCGGCGCCGGCGAGCGGGCCCCTGGCTCCGACGGTCGCCGCGGGGCGCCAGGAGAGGGAAGACGAGAGCCTCCT
CCCCGCAACCCTCAGCATCTCGTCGGCGTCGTCCTCGTCCTCCTCCGGTAGATTGGGGATGGTAGTCTAATCTCGGCTAGGGTTCGCTCGGTCGCCACAC
GGAATGGAGAGGCTAGAGAGAG
page-top