Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23870  (registered. 2003)
Contig Information
Length 1792 bp
Clones 21 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 7
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 1
Homology (BLAST) Top Hit Os04g0614600 [Oryza sativa (japonica cultivar-group)] >gi|33340007|gb|AAQ14479.1|AF297651_1 putative aminotransferase [Oryza sativa] >gi|38344251|emb|CAE04333.2| OSJNBa0008M17.4 [Oryza sativa (japonica cultivar-group)] >gi|113565434|dbj|BAF15777.1| Os04g0614600 [Oryza sativa (japonica cultivar-group)] >gi|215717129|dbj|BAG95492.1| unnamed protein product [Oryza sativa Japonica Group]
Score 2391
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23870
CCTTCGCCTCTCGCTCTGTATCTCTCCTCTCCGACGGAAGCAGCCATCGCTGATCCTCCTGTGTGGCCGCCGAGATGATTGCGCGCGGCCTGCTCCGATC
CAATGCCTCATCGCAGGCAAGCAAATTAGTGAAGTATTTAACCAGCGCCGGGAGCTTACAAGGGCATGCAGACAGCTTGTCAGATGCATCAGTCAGACAT
TTCAGTTCAGCATCGTCTCCTCAGACGAACTCAACTGAAGAAAATGGGTTTAAGGGGCATGGCATGTTGGCACCATTCACAGCTGGATGGCAGAGCAATG
ATGTGCATCCGCTGGTTATTGAGAGATCTGAGGGGTCTTATGTTTATGACATCAACGGGAATAAGTATCTAGATTCTCTAGCAGGACTCTGGTGTACAGC
TTTAGGTGGTAGTGAGCCTCGATTAGTCAAAGCTGCAACTGACCAATTAAACAAGTTGCCCTTCTATCACTCCTTCTGGAACCGTACAACCAAACCAACA
TTGGATCTTGCAGACGACCTTCTTAGCATGTTTACTGCAAGCAAAATGGGAAAGGCATTCTTCACAAATAGCGGTTCGGAAGCAAATGACTCACATGTCA
AACTAGTATGGTATTATAACAACGCATTGGGGAGGCCAAACAAGAAAAAGTTTATTGCACGATCAAAAGCATATCATGGATCAACATTAATATCAGCTAG
TCTCACTGGTCTTCCTGCCCTGCACCAGAAGTTCGATCTACCAGCACCTTTTGTTCTGCACACAGACTGCCCTCACTACTGGCGCTTCCATCTTCCCGGT
GAGACAGAAGAAGAATTTGCAACAAGACTTGCTAAAAATTTAGAGGATCTTATCCTCAAGGAAGGACCAGAAACAATTGCTGCGTTCATTGCTGAGCCTG
TCATGGGTGCTGGTGGTGTCATCCCTCCTCCAAAGACTTATTTTGATAAGGTTCAAGCTGTGGTTAAGAAGTATGACATCCTTTTCATAGTAGATGAGGT
CATTACCGCATTTGGAAGGTTGGGAACCATGTTCGGATCTGATATGTATAACATCAAGCCAGATTTAGTCACCTTGGCCAAGGCTCTTTCGTCTGCGTAT
GTGCCCATTGGAGCAACTCTTGTTAGCCCCGAAATAGCAGCTGTGGTTGATTCTCAGAGCAATAAGCTAGGTTCATTTGCTCATGGCTTTACATACTCTG
GCCATCCAGTTGCTTGCGCTGTTGCCATTGAAGCGTTGAAAATCTATCGGGAAAGGAATATTCCTGATCATGTGAAGCAAATCGCTCCACGCTTCCAGGA
GGGAACGAAGGCCTTTGCAGGAAGCCCAATTGTTGGGGAGATCCGTGGTGTAGGATTGATACTCGGAACTGAGTTCGCCAATAATAAATCACGAGATGAC
CCATTCCCTGCTGAATGGGGTGTTGGTGCTATATTCGGACAGGAGTGCCAGAAGCGTGGCATGCTGGTTAGGGTTGCCGGCGACAGCATTATGATGTCAC
CGCCTTTGACAATGACCCCCGGCGAAGTTGATGAGCTGGTGAGCATATACGGAGAAGCTATGAAGGCAACGGAGGAGAGAGTGGCGGAGCTCAAATCGAA
GAAAAACTAGACAATCTGTAAAGATAAGAGAGATTGACGACTTGATTGCAGACAAGATAGATTTGGTACATTCTTACCTGTAAAGATAATCTGCCAAATA
AAGCCGTTTATAAGCTTGCCCACTTTGATAATCTCTTGTACTGACACAATTTGAAACAATTTGAAAGAATTCCTTTGAGATCAAAAAAAAAA
page-top