Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23868  (registered. 2003)
Contig Information
Length 1120 bp
Clones 21 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 6
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 6
Homology (BLAST) Top Hit MIKC-type MADS-box transcription factor WM2 [Triticum aestivum]
Score 1206
Evalue 2.47028e-130
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23868
AGAAGTACCTGGGTTGCACTGCAGATAATTAAGTAGTATCATCACAATACATATGGATACATTGCACTGGGTGTGGCCAAGCCTTAATTATATGGGATAA
AGTTGATTGTGCGTGTATAGAAATACACACATTCATGGAAGTTCTAGTTATATATCACGCATATATATAGCTTCAATCTCACTTGAAGGTAAATGAGAGA
CGACACAGCTGTGCATGGATGCATCCATCACCTTCCAACTGAGTTGAAACTTTTTCGGTCCTCCTGCTGGGAGTAGTACTGAGGCTGCTGCTGCATGAAG
TTGAACTGCAGGAAGGTTCTCGGATCACAATGGATCATATTTTGCTCGTACTCATTCGATGTCGAAGCCGCCCCCATCATGTTCAACGTCTGCTGTTGCC
CCCTTTCAGTCTCAGCTACTTTTTCCCTCAAGAAGAAGTTGTTATTCTGCAGCTCCATTTCCCTTCTCTGCATGTACTCAATTTCAGCGCATAGTAATTC
GTTCTTTCTTGCTCTAATCTTTCCAAGGCCTTTGTCCAGCCTTCCCTCCAGCTGTTTCAGGTCTCTGTGGCTCATGGTGGCCATTGTATCGCCTATTAGA
GTCCTGTTGGAGTTCTGCAAGGTGGTTATCTGCTGCTTCAGCTTCGCAGATTCCTGCTGGTAGTGCTGGGCATTGATCTCTGCGACTGTACCAGCGCTGG
AGGTGTCACTTGTTGCCTTCTTGTATCTCTCAATGGTTGCTTTCACGCTGTTGTTGGAGTACTCGTAGAGGCGCCCGCGGCCGGAGAAGACGATGAGCGC
CACCTCGGCGTCGCAGAGCACCGAGAGCTCGTACGCCTTCTTCAGGAGGCCGTTGCGGCGCTTGCAGAAGGTGACCTGCCGGTTGGTCGTGTTCTCGATG
CGCTTGATCTCGATCCTCCCTCTCCCCATCTTCTCGGCAGCGCCCCCTGCCGATCCCGAGCCCGAGCCCGGGGACGCAGACTCCTTCACCATTAGGCCTG
TGGATGGTGCAGCCAGCTGCTCGTTGAGTATCTGCATGTTTGTGTTTCGTGGGCGCTAGAGAGAGATGGGAAGGATAGAGTGAGAGATGAGGAAGGCAAA
TGAGGGAGAAGAGTGTGTTA
page-top