Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23863  (registered. 2003)
Contig Information
Length 684 bp
Clones 21 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 5
Wh_OKCS Seed DPA5 4
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 3
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit glycoprotein [Bromus inermis]
Score 592
Evalue 1.66251e-59
Total Hit Count 302
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23863
GAATTCGGCACGAGGCCCGCCCACCCGTCTCCTCGCCTCGCCGTCTCGCCCCACGCCGCCGCCGCAAAGATGCCGTTCAAGAGGTTCGTCGAGATCGGGC
GCGTGGCCCTGGTGAACTACGGCAAGGACTACGGCCGCCTCGTCGTCATCGTCGACGTCGTCGACCAGAACCGGGCACTTGTGGATGCTCCTGATATGGT
CAGGTGCCAGATGAACTTCAAGCGTCTTTCGCTGACCGACATCAAGATTGACATCAAGCGTATCCCTAAGAAGGCAACTTTGATCAAGGCCATGGAGGAA
GCAGATGTGAAAACCAAATGGGAGAACAGCTCATGGGGTAAGAAGCTTGTTGTCCAGAAGAGAAGAGCATCGCTGAATGACTTTGACAGGTTCAAGGTCA
TGTTGGCTAAGATTAAGAGGGGTGGTGCTATCAGGCAAGAGCTTGCCAAGCTCAAGAAGGAGGTTGCTGCTTAGAATATCCTAGTGGATGGCATGTTGAG
TTTTTTTGTTCCAAGTTGGATCTGCTCTATGTTCCAGTGTTCTTAAAGCCAGAATTAGTACAACTGTTTTCAGCGAACTATTTCATATTTTGTCATGGCT
GTTATTGAATACCCAAGCTAGTTTGCTACAGATGTGCCTCTTGCCTTATTCATATGTGATATGTTGCCCGGTTCAAAAAAAAAA
page-top