Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23841  (registered. 2003)
Contig Information
Length 1286 bp
Clones 21 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 5
Homology (BLAST) Top Hit Os07g0615200 [Oryza sativa (japonica cultivar-group)] >gi|23237931|dbj|BAC16504.1| unknown protein [Oryza sativa Japonica Group] >gi|113611804|dbj|BAF22182.1| Os07g0615200 [Oryza sativa (japonica cultivar-group)] >gi|215696974|dbj|BAG90968.1| unnamed protein product [Oryza sativa Japonica Group]
Score 746
Evalue 6.57793e-77
Total Hit Count 222
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23841
AATATGAATCCATTACAATCACTTGCTTTTACAAATCAAGGATAAAACTCAATGACAATACGGAATGATCAGAGTTTACATATAGGATACAAATATGTTT
CTTTGCACTAACTTTTTTTCCTTAGCATGGCCAACTCAATATCACCATGTGTTAACATGCCAAAACTTCTCTCGGGCTTCGGGCACCGGTCATCATCATT
TGCTACTTCTCTTTACATCGGAACTATGGAGGCGAATAACACAGAACCATAACCTAAACAAAACGCTAGGACAAAGCACATTTCAGATGTTTCTGGTAAG
GGCATAAGGCTCCTGTCATGCCGCCTTATTGGTTTGGCTTCAGGGCGGCATTCGGCCCCAGTCCAAGCCATGGCTGGTTCTCAAACTCCTTCTTGACTGG
TGTTGCATCAGAAGGAGAAGCTTGATATGGTGCCTTTGCATGCAGACGATCCTTTCTCTTCTCAAGGAATCGGTGAAGTGACGCCTTTCTAGCAATTGGC
AGATCAGAAGCATTCGGACGAGCAGACTTAGGAGCAACAACCGGATCACTAGGCAAACTACTTGCCGGGGCCAGCACGGCCGTCTGGACCTTGGCGGTGT
CTGCAGCAGTTGTGGTCGCAGAGACGTTCTGAGCAACCGGGCTGCCCTTGCCAGCCAACTGCATCAGGCCCTTGGCCTTGTCGGCTGGGAAATCGTTGAA
CACGAGCACCTTCCCACCATAGAAGATGGTCAGCTGGCTCTTGTCTTCCTCCCTAGTAGCGTCAGGGGCGGCGGCGTCCTGCAGGCCGGCGCTCTGCGGG
AAGAGCTCCATGGTCTCCTTCTTCCTGCCGGCCTCCTCGCCCTCCGCCCCAGGCAAAGGGCTCTTGGTGTCCGCCGTCCTGTGAGCCTCGGCCTCACCCT
TGTTGATTCCGAGGCCGAGCTCGGCCGCGGCGGCGCCGTTCTGGCGGACGTAGCGGCTGAGCAGGCTGCAGGCCATGGCGAAGCTGGTCGCCCTCTCCCC
CTGCCTCGCGGAAGCCGCCATCTCCGGTCTCTCTCTCAGCTCCACCTCCGAACCTCCTCCCCTTCCTCCAAACAAACCTTAATAGCGCAGACGGAATCGG
AATCGGCCGAGCTCGCTCGTGGTGCTAGTCTCGCGGCGGTGGTGGTTGGCTCGCCTTCCTCGTGCTGTCTGTCGTGCGGTGCGGGATGGTAGTGTGCCGT
GTGCGTACGCGTCGTGCGCGTTTATAAGGGAGGACGCGGTTTCTGGCTTGGCAAACTGAAATCTCGCCCCCGCGGTGGAAAACGGA
page-top