Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23822  (registered. 2003)
Contig Information
Length 774 bp
Clones 20 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 8
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit RecName: Full=Histone H2B.2
Score 528
Evalue 5.58548e-52
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23822
CCTCCCCTCCCTCCAGCAAACTCACGCATCCCACCACCGAAGCTCCCAACCCCACCCGAAGCGGCAGCCATGGCCCCCAAGGCAGACAAGAAGCCGGCCG
CCGAGAACAAGGTCGAGAAGGCGGCGGAGAAGACCCCCGCGGGCAAGAAGCCCAAGGCCGAGAAGCGGCTGCCGGCGGGCAAGACGGCGTCCAAGGAGGC
CGGCGGCGAGGGCAAGACCCGGGGCCGCAAGAAGGGCAGCAAGGCCAAGAAGGGCGTGGAGACGTACAAGATCTACATCTTCAAGGTGCTGAAGCAGGTG
CACCCCGACATCGGCATCTCCTCCAAGGCCATGTCCATCATGAACTCCTTCATCAACGACATCTTCGAGAAGCTCGCCGGGGAGTCGGCCAAGCTCGCCC
GCTACAACAAGAAGCCCACCATCACCTCCCGGGAGATCCAGACCTCCGTCCGCCTCGTCCTCCCCGGGGAGCTCGCCAAGCACGCCGTCTCCGAGGGCAC
CAAGGCCGTCACCAAGTTCACCTCCTCCTAGACTGAAGATGCGCCGCTTGTTGTGCCAGATGTGGCTGTCTGATGTATCTCTGCTGTTGACTCTGCTTAC
CTGCAAGTAGAAGTAGTGGTAGTAGTTCGTGTGGTAGAAGATTGCCAACGCTTTGTTGGCTTCTTGGTTGTGAGAACTGAACGTGTTGCTTTTGCAAAAT
GAAATCTATCTAGAAAATGTTGCGGTTGTGGTACTACTACATCTATGTCACCGATGTTCGTACTAAAAAAAAAA
page-top