Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23798  (registered. 2003)
Contig Information
Length 573 bp
Clones 20 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 6
Wh_VWD Shoot grown with dessication 7
Homology (BLAST) Top Hit hypothetical protein OsI_12555 [Oryza sativa Indica Group]
Score 282
Evalue 9.58238e-24
Total Hit Count 18
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23798
CCGCAACGCAACCGAGAGAGAGAATCAGATCTTGGCGGACTCGAATCCAATCCAATCCAATCCAAGGCGGAGGTCGAGATCAAACCTACCGGAGATGAAG
TTCTTCTCGGCGTTCGACCCGTGGCCGGTGTTCTTCCGCCGGGAGTGGGGCCGCACCTGGCCCTTCCTCGCCGGCTTCGCCGTCACGGGGGCCCTCATCA
CCAAGATGACCGCCGGCTTCACCGAGGAGGACCTCAAGAACTCCAAGTTCATCCAGGCGCACAAGAAGAAGTAGTCGCCGCCCGCCCGGCCCGTCCGCCG
CCAGGTCACAGGGGCAGCAGCTGAGTAACCAGCATGTGTCCTTGATGCGGGGAGCCAGTCCTCACCCTCACTATTGTGATTGAGCTTTTATGTTTTTTTT
TTCAAATCCAACTGCATGCATTTTTGCTGCTCTGGTTTGTAATGTAATAAGCGACATTTGAATCGTTGAATCCAAGAAAAAAAACGGCTTCGGATAAAGT
AGCTGCCATGGGTCACTCTGTCTATGTACAATGAAAACGCTCTCTATTTCGTTTCGTGGATCTAAAAAAAAAA
page-top