Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23797  (registered. 2003)
Contig Information
Length 1590 bp
Clones 20 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_EM Dormant seed with water absorption 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 5
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit hypothetical protein OsI_07530 [Oryza sativa Indica Group]
Score 955
Evalue 5.08714e-101
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23797
ATTATTATATTGCTTTGATCCCTCATGGTCCATAACTGTAGGAACAAATATTCTCTTACATGACAGTATTTTATTAATGCTCTATTGGCGGAAAATCACC
AAGTTGCAAACACAGGGATACCTTTTTTTTTGCGGGGGAAACACAGGGATACCTTGCACAGAGGCAAATCATTCTTTTTGCAGGGAGAAGCTAGACTTAC
AAACGATCTACCATTTGGTTCGTGGACCCCGTGTTTTCCCAAGATAGAGCATTGTGGAGCTCATGTCCTCTTCATAAAAGTGGAACCTAGGATGATGATG
TCTTGCCATCCAACGTCAGTAGCACTTTGTATAGATCAGGACGCCTGTCCCTGAATATACCCCAGCCGTGCCTCGTAGATTTGATCTCGTCCAAGTCAAA
CTCCGCGACGAGCACCTCCTCGTCTTTGTCATTTGCAAGCTTCACGATTTCTCCAGTTGGCCCTGCGATGAATGAGTTCCCATAGAACTTTATGGTGCTG
TTGCCATGCTCAGTCTCAACAGTTTCCTTACCTATCCGGTTAGAAGCAACAAGAGGAACCTGTTGGGCACATTAAGGTGAATCACGAAACCGTGAGAACT
CTTGAACCAACTGGTAGAAACATTTAGAAATAGAAGAGATGTCTTCTAGACTCGTGAAAGAAGATACGGGTCCATTTAAGGACATTAAACAGAACAGCTA
ACAGTACCAAGTTAGCACCGGCATGGCCTTGCATGACACGCTTCCAGTGTTCGCGGGAATCCAGGTTCATATCCTGGGGTTCAGAACCAATAGCAGTGGG
ATAGAACAATATCTCCGCCCCCTGTAGCACCATAGCCCTTGCGGTCTCTGGAAACCACTGGTCCCAACAAATTCCAACACCAATTGTTGCATACTTGGTT
TTGAAAGCCTTGAATCCAGTGTCACCCGGGTTGAAATAAAATTTCTCTTGATAACCTGGTCCATCTGGAATGTGTGATTTGCGGTATAGGCCAAGATCGG
TGCCATCAGCATCAATAATGGCCACGGAATTGTAATGAGCATTGCCCGCTTCTTCAAAGAAACTTACAGGTATTACAACATCCAACTCCTTTGCAAGCTT
TTGCATTCTCATTATAGTCGGGTTCTCTTTATAAGGCTTGGCACGCCCAAAGAAATCCATCCTTTGAGCCTGACAGAAATAGTGCCCCTCAAATAGCTCC
TGAATGAGGACAATGTTCGCACCTTTCTTATGAGCTTCTCTAATCAACCTCTCGGCGGCGGCGACGTTGTCGGCCACCGTGTCGGTGCAGGCGAACTGCA
CGGCGGCGACTGCCACCTTCCTCCCCGCGCCGGCCATCTCCCACCTCTCTCCTCCTCACCTACCCCTTCCTCGACCCGCGCTGTTCCGCTTGCTTTCCTC
TGACGGCGGAGAACGGTGCGGCGGCCGGCGGGAGGTGGGGTTCCTGGCGAGCGGGGAAGGCGAGCCCTAGGCGGATCCCGGCGGCGCGAGGCAGCGGGGA
AGCAAGCTGTCCCGGCGGCAGTGTAGTGGCGTGGCGGCAGTGTGCAGATGGGGAGGGGAAGGGAGGACGCCCTTTGGGGAAAACCGCTTC
page-top