Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23791  (registered. 2003)
Contig Information
Length 840 bp
Clones 20 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 5
Wh_EMC Dormant seed with cold treatment after water absorption 12
Wh_EMI Dormant seed with water absorption after breaking 3
Homology (BLAST) Top Hit unknown [Picea sitchensis]
Score 361
Evalue 1.49193e-32
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23791
TACCTGTCTCGTGGGGCATCGTGGTCAACCGAACACCGGCCGTGCGTGTCAGCCATGTTCGCTCATGCCTTGGTTCGGCGGTGGCCGGGGAGGGATGGAC
CCCTTCTCCTCCGACCTCTGGGACCCCTTCGGCTCTCCTTGGCCCTTGGACGGCGGCCGCCGCGAAGGCGGCAGCCGTGACGACGCGACCGCCATGGCTC
GCACCAACGTCGACTGGCACGAGAACGACAAGGAGCACATCTTCTCCGCGGAGATCCCCGGGGTGCGGAAGGAGGACGTGAAGGTGGAGGTGGAGGACGG
CAACGCGCTCAAGATCAGCGGGGAGAAGACGCGGGAGGAGGAGCACAAGGGCGACGCCTGGAACCGCGTGGAGCGCAGCTTCGGGTCCTTCATGCGCCGG
TTCCGCCTGCCGGAGAACGCCAAGGCGGACAGCATCCGGTGCACCATGCAGGACGGCGTGCTCAGGGTCGTCGTTCCCAAGGACGAGGAGGCACAGAAGC
AGCGCAACGTCCGCTCCATCGACATAGCCTAAAGGCTAAAAGCACCGCGCCTACGCATACAGTCAACGGCTTCCTAGCGTGACAATGCCATCTCCTCTTT
TATTAGCGTGTACTCGTGGTAGTAATCTGTATCGTGTGTTCTACTTTAGCAGTAATGCTAGGTTATTCTGTACGGTAGTTTAGAAGTGTGCTTTATGCGC
CATATAGCTGCTACGGCATATGGCACTTTTAATCGTGTTGAGTCCAAGAATTTACTGCTAGTGGACGAGCATCCATCGTAAACTGTACCAGAAAGGACCA
GAAACAGATTCGGAAGATGAAAGGGGCAGCAGAGAAAGCA
page-top